BioSc 231 General Genetics Exam 1 Name ______
Multiple Choice. (1 point each)
_____ The chemical bonds in DNA by which the sugar components of adjacent nucleotides are linked through the phosphate groups are called ____ bonds.
A. phosphodiester
B. hydrogen
C. hydrophobic
D. hydrophilic
E. ionic
_____ The basic structure of a nucleotide includes the following components:
A. amino acids
B. tryptophan and leucine
C. base, sugar, phosphate
D. mRNA, rRNA, tRNA
E. phosphorous and sulfur
_____ Which of the following is not an essential attribute that a biological molecule would need to be a useful genetic material?
A. It must carry all of the information needed to direct the specific organization and metabolic activities of the cell
B. It must replicate accurately so that the information it contains is precisely inherited by the daughter cells
C. It must be capable of undergoing occasional mutations, such that the information it carries is altered in a heritable way
D. It must have highly repetitive DNA sequences.
E. All are essential attributes of useful genetic material.
_____ The presence of a ___ with a free 3'-OH group is essential for DNA polymerase to synthesize DNA since no known DNA polymerase is able to initiate chains.
A. origin of replication
B. restriction endonuclease
C. palindrome
D. primer
_____ Considering the structure of double stranded DNA, what kinds of bonds hold one complementary strand to the other?
A. ionic
B. covalent
C. Van der Waals
D. hydrogen
_____ A ___ is an enzyme that recognizes a short nucleotide sequence in a DNA molecule and cleaves the molecule at that site.
A. 5' - 3' exonuclease
B. 3' - 5' exonuclease
C. Taq polymerase
D. topoisomerase
E. restriction endonuclease
_____ The technique used to separate molecules on the basis of their different rates of movement in an electric field is known as ____.
A. gel electrophoresis
B. gradient centrifugation
C. ultracentrifugation
D. Southern hybridization
E. PCR
_____ A ___ involves the transfer of DNA fragments from a gel matrix to a nitrocellulose membrane where specific DNA sequences can be detected using radioactive probes.
A. PCR reaction
B. restriction enzyme digest
C. DNA seqeuncing reaction
D. Southern blot
_____ In crosses involving two different unlinked traits, the ratio 9:3:3:1 indicates ___.
A. Codominance
B. Independent assortment
C. Intermediate dominance
D. Three alleles for each trait
_____In a cross of a round hybrid pea with a true breeding round parent (Ww x WW), what genotypic proportions would be observed in the offspring?
A. Half heterozygous, half homozygous dominant
B. Half round, half wrinkled
C. All heterozygous
D. All round
_____ The fundamental Mendelian process which involves the separation of alleles would be called ___.
A. segregation
B. independent assortment
C. continuous variation
D. discontinuous variation
E. dominance or recessiveness
_____ What phenotypic or genotypic ratios typically result from crosses dealing with a single genetic locus?
A. 9:3:3:1, 1:2:1
B. 1:1:1:1, 1:4:6:4:1
C. 3:1, 1:1, 1:2:1
D. 9:7, 12:3:1
E. 15:1, 1:2
_____ The base thymine is always paired with ___.
A. Adenine
B. Guanine
C. Cytosine
D. Thymine
_____ The sequence of one strand of DNA is 5’ TCGATC 3’. The sequence of the complementary strand would be ___.
A. 5’ AGCTAG 3’
B. 5’ TCGATC 3’
C. 5’ CTAGCT 3’
D. 5’ GCTAGC 3’
E. 5’ GATCGA 3
_____ Starting with a cross between AA and aa in the P generation, the proportion of heterozygotes in the F2 progeny will be ___.
A. 1/8
B. 1/4
C. 1/3
D. 1/2
E. All heterozygotes
_____ Genotype is to DNA as phenotype is to
A. Genotype
B. Proteins
C. Expressivity
D. RNA
E. Mutation
_____ Starting with a P generation with the following genotypes (AABB x aabb). Based on classical Mendelian inheritance, what is the expected phenotypic ratio observed among the F2 progeny?
A. 9:3:3:1
B. 1:2:1
C. 3:1
D. 1:1
E. 1:1:1:1
_____ In the previous question, if A = brown fur and a = red fur and B = straight tail and b = curled tail, what phenotypic class would be observed in the highest proportion?
A. red – curled tail
B. brown – curled tail
C. red – straight tail
D. brown – straight tail
_____ A species of mice can have gray or black fur and long or short tails. A cross between black-furred, long-tailed mice and gray-furred, short-tailed mice produce all black-furred, long-tailed offspring. Using the gene symbols G for black, g for gray, S for long and s for short, what would be the genotype of a gray-furred, short-tailed mouse?
A. WWSS
B. wwSS
C. wwss
D. WwSs
E. Wwss
_____ Referring to the previous question, how many different gametes will the gray-furred, short-tailed P1 mice produce?
A. 1
B. 2
C. 4
D. 16
_____ To determine if an organism with a dominant phenotype is heterozygous, one can perform a ___.
A. reciprocal cross
B. dihybrid cross
C. test cross
_____ In the F1 dihybrid cross (WwGg X WwGg), in which W = round, w = wrinkled, G = yellow and g = green, what is the probability of obtaining an individual that is round, green and true-breeding?
A. 1/16
B. 1/2
C. 9/16
D. 3/16
_____ What genotype is present most often among the progeny (F2) of a dihybrid cross (AaBb X AaBb)?
A. AaBb
B. AABb
C. AABB
D. aabb
____ The Hershey and Chase experiment which offered evidence in support of DNA being the genetic material in bacteriophage made use of the following labeled components
A. phosphorous and sulfur
B. nitrogen and oxygen
C. tritium
D. hydrogen
_____ Which of the following are pyrimidines?
A. adenine and guanine
B. thymine and cytosine
C. thymine and adenine
D. cytosine and guanine
_____ The process of producing a RNA polymer from a DNA template is called __.
A. replication
B. transcription
C. translation
D. duplication
_____ The process of producing an amino acid polymer (polypeptide) from a RNA template is called __.
A. replication
B. transcription
C. translation
D. duplication
_____ The basic principle that DNA makes RNA makes protein is referred to as the __.
A. Golden rule of molecular biology
B. Central dogma of molecular biology
C. Core of molecular biology
D. Gene that laid the golden egg
Short Answer. (1 point each)
If one of the strands of a piece of DNA has the sequence 5'-GAGCCATGGTC-3', what is the sequence of the complementary strand? Label the termini as 5' or 3'.
Synthesis of DNA is catalyzed by an enzyme called ______and synthesis of RNA is catalyzed by an
enzyme known as ______.
In your own words, what is the meaning of the term allele?
If the G + C content of a DNA molecule is 56%, what are the percentages of all four bases?
A
C
G
T
In unicorn genetics, silver coat color (P) is dominant to purple coat color (p) and smooth horn (H) is dominant to helical horn (h). In the cross PpHh x PpHh what fraction of the unicorns will be:
A. Silver
B. Smooth Horned
C. Purple and helical horned
D. Silver and smooth horned
E. Purple and smooth horned
Assume that you have a garden and some pea plants have solid leaves and others have striped leaves. You conduct a series of crosses and obtain the results given in the table. Complete the table by entering the probably genotype for each of the plants.
Cross / ProgenySolid / Striped / Genotype 1 / Genotype 2
A. / (1) Solid x (2) Striped / 44 / 0
B. / (1) Solid x (2) Solid / 92 / 29
Draw a Punnett square for the following cross: Dd x Dd
If D represents the dark fur color trait in dogs, which is dominant over light fur color (d), what would be the phenotypic ratio of the offspring resulting from the cross in the previous question?
Draw a Punnett Square for the following cross: AaBb x AaBb (4 points)
Complete the structure of the nucleotide below by filling in the boxes with the letter of the appropriate functional group.
Using the key to the right, write the appropriate genotype
for each of the gel electrophoresis images below.
Using the genetic code below, translate the following mRNA sequence (5 points).
5’ CGAGAUGAUAAACGAGAGGGGGGAAAAUGAGACGAUAUGCAGCUAAUGAGCAGGUUUUC 3’
What would be the consequence if, due to a mutation, the underlined base was changed to a U?