TREE CONSTRUCTION

  1. Definition of a phylogenetic tree
  1. Features of a phylogenetic tree
  • Branches
  • Nodes (External & Internal)
  1. Unrooted trees
  1. Rooted trees
  • Choice of an outgroup
  1. Inferred and true trees
  1. Gene trees are not the same as species trees
  1. Tree reconstruction

7.1 Molecular sequences

7.2Sequence alignment is the essential preliminary to tree reconstruction

7.3 Converting the alignment data into a phylogenetic tree

7.4Assessing accuracy of a reconstructed tree

7.5Molecular clocks enable the time of divergence of ancestral sequences to be estimated

  1. The applications (examples) of molecular phylogenetics
  2. Clarifying evolutionary relationships between humans & other primates
  3. The oldest life on earth (rRNA and phylogeny)
  4. The origin of Aids
  5. Problems with prion
  1. Molecular phylogeny as a tool of the study of human prehistory
  2. Intraspecific studies require highly variable genetic loci
  3. The origins of modern humans - out of Africa or not?
  4. The pattern of more recent migration into Europe are also controversial
  5. Prehistoric human migration into the new world
  1. Exercises for drawing a phylogenetic tree
  1. Software packages for reconstruction of phylogenetic trees

  1. Definition of a phylogenetic tree

A tree is an acyclic connected graph that consists of a collection of nodes (internal and external) and branches connecting them so that every node can be reached by a unique path from every other branch.

Figure: An unrooted phylogenetic tree joining 4 taxonomic units.

2. Features of a phylogenetic tree

In the area of phylogenetic inference, trees are used as visual displays that represent hypothetical, reconstructed evolutionary events. The tree in this case consists of:

internal nodes which represent taxonomic units such as species or genes; the external nodes, those at the ends of the branches, represent living organisms.

The lengths of the branches usually represent an elapsed time, measured in years, or the length of the branches may represent number of molecular changes (e.g. mutations) that have taken place between the two nodes. This is calculated is from the degree of differences when sequences are compared (refer to “alignments” later)

Sometimes, the lengths are irrelevant and the tree represents only the order of evolution. [In a dendrogram, only the lengths of horizontal (or vertical, as the case may be) branches count].

Finally the tree may be rooted or unrooted.

  1. Unrooted trees

An unrooted tree simply represents phylogenetic but doesnot provide an evolutionary path. In an unrooted tree, an external node represents a contemporary organism. Internal nodes represent common ancestors of some of the external nodes. In this case, the tree shows the relationship between organisms A, B, C & D and does not tell us anything about the series of evolutionary events that led to these genes (see figure above). There is also no way to tell whether or not a given internal node is a common ancestor of any 2 external nodes.

  1. Rooted trees

Gene trees are not the same as species trees

In case of a rooted tree, one of the internal nodes is used as an outgroup, and, in essence, becomes the common ancestor of all the other external nodes. The outgroup therefore enables the root of a tree to be located and the correct evolutionary pathway to be identified. In the above case, five different evolutionary pathways are possible using an outgroup, each depicted by a different rooted tree.

5. Inferred and true trees

The criteria used to choose an outgroup depends very much on the type of analysis that is carried out. Suppose that 4 homologous (orthologous) genes in a tree come from human, chimpanzee, gorilla and orangutan. A useful homologous primate outgroup sequence is that from baboon as palaeontological evidence suggests that baboons branched away from the lineage leading to human, chimpanzee, gorilla and orangutan before the time of the common ancestor of the four species (figure below).

Figure: The use of an outgroup to root a phylogenetic tree.

We refer to the rooted tree given above, as an inferred tree. This is to emphasise that it depicts the series of evolutionary events that are inferred from the data that were analysed, and may not necessarily be the same as the true tree, the one that depicts the actual series of events that occurred. Sometimes we can be fairly confident that the inferred tree is the true tree but most phylogenetic data analysis are prone to uncertainties. Degrees of confidence can be assigned to the branching patterns in an inferred tree using bootstrap analysis (discussed in a later section). Due to the imprecise nature of phylogenetic analysis controversies have arisen.

6. Gene trees are not the same as species trees

The above tree is a gene tree i.e. a tree derived by comparing orthologous sequences (those derived from the same ancestral sequence). The assumption is that this gene tree is a more accurate reflection of a species tree than the one that can be inferred from morphological data. This assumption is generally correct but it does not mean that the gene tree is the same as a species tree.

Mutation and speciation are not expected to occur at the same time. For example, the mutation event could precede the speciation event. This would mean that, to begin with, both alleles will still be present in the same unsplit population of the ancestral species. When the population split occurs, it is likely that both alleles will be present in each of the resulting groups. After the split, the new population evolve independently. One possibility is that as a result of random genetic drift loss of one allele from one population and the loss of the other allele from the second population occurs. This establishes the two separate genetic lineages that were inferred from phylogenetic analysis of the gene. How do these considerations affect the coincidence between a gene and a species tree?

(a)If a molecular clock is used to date the time at which gene divergence took place, than it cannot be assumed that this is also the time of the speciation event. A significant difference between a gene and a species event can exist though the species tree & gene tree look the same (see LHS figure a below).

(b)If the first speciation event is followed closely by a second speciation event in one of the two populations, then the branching order of the gene tree might be different to that of the species tree. This can occur if the genes in the modern species are derived from alleles that had already appeared before the first of the two speciation (RHS Figure, below)

7. Tree reconstruction

In any molecular phylogenetic reconstruction the following 4 points need to be addressed.

  • Molecular sequences
  1. Sequence alignment is the essential preliminary to tree reconstruction
  2. Converting the alignment data into a phylogenetic tree
  3. Assessing accuracy of a reconstructed tree
  4. Molecular clocks enable the time of divergence of ancestral sequences to be estimated

7.1 Molecular sequences

Nucleic acids (rRNA, DNA) and protein sequences are used in molecular phylogenetic tree construction. DNA yields more phylogenetic information than DNA and has become by the far predominant molecule for phylogeny:

  • More statistical information from DNA data: The nucleotide sequences of a pair of homologous genes has a higher information content than the amino acid of the corresponding proteins, because mutation that result in nonsynchrononymous changes affect only the DNA sequence. Hence coding as well as non-coding regions of the genome can be examined. Write out the DNA sequences or the following two amino acids as an example of this. You can see that at the protein level there is only 1 difference but at the nucleic acid level there are 3 differences.

Protein1 -gly-ala-ile-leu-asp-arg-

DNA1 -gga-gcc-ata-tta-gat-aga

DNA2 -gga-gca-att-ttt-gat-aga-

Protein2 -gly-ala-ile-phe-asp-arg-

  • Ease of sequencing DNA: Samples for DNA sequencing can be prepared by PCR which is an extremely easy technique.

Protein electrograms, Restriction fragment length polymorphism (RFLP), Simple sequence length polymorphism (SSLP), Single nucleotide polymorphism (SNP) and DNA-DNA hybridazation data have also been used for molecular phylogenetic reconstruction. Immunological data from cross-reactivity studies were used in 1904 for such work as well.

7.2 Sequence alignment is the essential preliminary to tree construction.

This is the most important step in molecular phylogeny and a number of issues have to be considered:

  • Sequence Homologs: Sequences that are to be aligned should be homologs. An example of this are the -globin genes of different vertebrates. This is to satisfy the phylogeny criteria which states that the sequence should be derived from an common ancestral sequence.
  • Non-homologous sequences: If the sequences are not homologous and hence do not share a common ancestor phylogenetic construction methods will always produce a tree but the tree will not be of any biological relevance. This type of error commonly occurs when undertaking homology analysis to assign functions to newly generated gene sequences. Blast is used extensively as on of the homology analysis methods and hence interpretation of the data arising from the analysis should be undertaken with care.
  • Easy alignments: Correctly aligning the homologous sequence is the next task. In some cases it is an easy task. A simple sequence alignment is shown below:

Sequence 1 AGCAATGGCCAGACAATAATG

Sequence 2 AGCTATGGACAGACATTAATG

*** **** ****** *****

  • Difficult alignments: If sequences have evolved and diverged by accumulating insertions and deletions as well as point mutations, then these sequence are not always easy to align. Insertions and deletions cannot be distinguished when pairs of sequences are aligned so we refer to them as indelsBelow is a pair of difficult sequences for alignment where placing the indel at the correct location can become a problem.

Sequence 1 GACGACCATAGACCAGCATAG

Sequence 2 GACTACCATAGA-CTGCAAAG

*** ******** * *** **

Sequence 1 GACGACCATAGACCAGCATAG

Sequence 2 GACTACCATAGACT-GCAAAG

*** ********* *** **

  • The dot matrix technique foralignment: Some alignments can be easily done by "eye balling" the sequences yet others may require a pen and paper.The simplest is known as the dot matrix method. The two sequences are written out on the x- and y-axesof the graph paper at the positions corresponding to the identical nucleotides of the two sequences. The alignment is indicated by a diagonal series of dots broken by empty squares where the sequences have nucleotide differences, and shifting from one column to another where indels occur.

AGA C ATTTAGACCAA

Figure: The dot matrix technique for sequence alignments

  • Similarity approach is a mathematical based alignment technique: The similarity approach (Needleman and Wunesh, 1970) aims to maximise the number of identical matched nucleotides in the two sequences. The distance method,(Waterman, 1976) on the other hand, minimises the number of mismatches. Often the two approaches will identify the same alignment as being the best one.
  • Multiple alignments are generated for more then two sequences: Rarely can one do multiple alignments with a pen and paper and all the steps required for phylogenetic analysis is undertaken on a computer. Forautomatically generating multiple alignments several computer programs are available (discussed later)
  • rRNA genes (aka rDNA) and rRNA have been used as molecular chronometers and phylogentetic studies undertaken. Refer to the section on rRNA for detailed notes on the methods of aligning these types of nucleic acids.

7.3 Converting the alignment data into a phylogenetic tree