Supplemental Experimental Procedures

Transfection and protein analysis

Mammalian expression vectors for Snail were transfected into PC3, A549, 293, or Capan-1 cells using the jetPEI reagent, according to the manufacturer’s protocol (Polyplus transfection). Briefly, 2 µg of DNA and jetPEI mixtures were added to cells and incubated for 3 h under serum-free conditions, after which equal volumes of DMEM containing 20% serum were added. After 24-h incubation, cells were incubated with the agents indicated in the text for 3 h and were subsequently harvested using RIPA buffer (containing protease cocktail). Twenty micrograms of protein lysate were applied to SDS-PAGE. After the proteins were transferred to a PVDF membrane, samples were incubated with the appropriate antibodies, according to standard western blot protocols. For in vitro gene knockdown, we generated siRNAs for CK1α and CK1ε(Liu et al., 2002). Using the jetPEI reagent, we transfected the siRNAs and checked the effect after 24 h.

Phosphorylation of Snail fragments

To phosphorylate the recombinant Snail proteins, 15 µg of each GST-fused Snail fragments or 1 µg of Snail-MC was incubated for 4 h at 37°C with 0.2 µg of recombinant GSK3β and 0.2 µg of recombinant CK1ε kinase domain in 25 µl of 50 mM Tris (pH 8.0) buffer containing 1 mM ATP, 10 mM MgCl2 and 10 mM 2-mercaptoethanol.

Western blotting

Proteins were analyzed by SDS-PAGE and western blotting using PVDF membrane. Non-specific sites were blocked with 3% nonfat milk at room temperature for 1 h. Primary antibodies were incubated in 1% nonfat milk overnight at 4°C or 1 – 3 h at room temperature at the dilutions provided in the manufacturer’s protocol. Specifically, anti-phospho-β-catenin (S33/37/T41) antibody was used at a dilution of 1:1000. Blots were washed with PBS/0.05% Tween 20.

Immunoprecipitation

Cell lysates were centrifuged for 20 min at 10,000g and the resulting supernatant was precleared by incubation with immobilized ProteinA/G gel (25 μl; Pierce) for 1.5 h at 4 °C. The precleared supernatant was subjected to overnight immunoprecipitation using antibody indicated in the text at 4 °C. The next day protein complexes were collected by incubation with 25 μl immobilized Protein A/G gel for 1.5 h at 4 °C. The collected protein complexes were washed four times with co-immunoprecipitation buffer and eluted by boiling in Laemmli sample buffer under reducing conditions after which proteins were resolved on SDS–PAGE and analysed by western blot.

RT-PCR

RT-PCR analysis was performed with a SuperScript One-Step kit and Plantinum Taq polymerase (Invitrogen) with 1 μg of total RNA and primers corresponding human Claudin3 (forward, 5’- aacaccattatccgggacttctac; reverse, 5’- gtctgtcccttagacgtagtcctt), Fibronectin (forward, 5’- aagagacagctgtaacccagactt; reverse, 5’- aagtgcaatcagtgtaattgtggt), and GAPDH (forward, 5’- atgggtgtaaccatgagaag; reverse, 5’- agttgtcatggatgaccttgg). Thirty-cycles were used for the analysis.

Reference

Liu C, Li Y, Semenov M, Han C, Baeg GH, Tan Y, Zhang Z, Lin X and He X. (2002). Cell, 108, 837-47.

Supplemental Figure Legend

Suppl. Fig. S1. A cell-type dependent effect of the GSK3β and CK1ε inhibitors in the stabilization of Snail. The Capan-1 cell line was treated with 50 mM lithium chloride, 100 μM IC261, or 5 mM ALLN, and then the cell lysate was analyzed using each antibody indicated. Actin is shown as a loading control. Snail protein level was very weakly increased, which is distinct from the results from the PC3 and A549 cell lines (Fig. 4E).

Suppl. Fig. S2. Cross-reactivity of siRNA for CK1alpha toward CK1epsilon. siRNA for CK1alpha suppressed CK1epsilon as well as CK1alpha. This observation can explain why siRNA for CK1alpha partly increased the Snail stability in cell, as shown in Fig. 5A.


Suppl. Fig. S3. Verification of the result shown in Fig. 3D.

GST-fused Snail-L fragment (1 mg/ml) was used instead of Snail-MC (40 μg/ml) in the reaction.