The CHCHD10 P34S variant is not associated with ALS in a UK cohort of familial and sporadic patients

Chun Hao Wong1, Simon Topp1, Athina Soragia Gkazi1, Claire Troakes1, Jack W Miller1, Martina de Majo1,Janine Kirby2, Pamela J Shaw2, Karen E Morrison3, Jacqueline de Belleroche4, Caroline A Vance1, Ammar Al-Chalabi1, Safa Al-Sarraj1, Christopher E Shaw1* and Bradley N Smith1*

1Institute of Psychiatry, Psychology and Neuroscience, Maurice Wohl Clinical Neuroscience Institute,King’s College London, 125 Coldharbour Lane, Camberwell, London, SE5 9NU, UK.

2Sheffield Institute for Translational Neuroscience (SITraN), University of Sheffield, Sheffield, S10 2HQ, UK.

3School of Clinical and Experimental Medicine, College of Medical and Dental Sciences, University of Birmingham, Birmingham, UK

4Neurogenetics Group, Division of Brain Sciences, Hammersmith Hospital Campus, Du Cane Road, London W12 0NN

*These authors contributed equally to the manuscript

† Corresponding author: Dr Bradley Smith, Department of Basic and Clinical Neuroscience, Rm 1.29, Floor 1, Maurice Wohl Clinical Neuroscience Institute, 125 Coldharbour Lane, Camberwell, London, SE5 9NU.

(T) +44 207 8480974 E-MAIL

Abstract

Mutations in CHCHD10 have recently been reported as a cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). To address the genetic contribution of CHCHD10 to ALS we have screened a cohort of 425 UK ALS+/-FTD patients and 576 local controls in all coding exons of CHCHD10 by Sanger sequencing. We identified a previously reported Pro34Ser variant that was also present in neurologically healthy controls (p=0.58). Our results suggest that CHCHD10 is not a primary cause of ALS in UK cases.

  1. Introduction

Amyotrophic lateral sclerosis (ALS) is an adult-onset neurodegenerative disease characterised by lower and upper motor neuron degeneration. Approximately 5-10% of ALS cases are familial (FALS) with the remainder presenting in a sporadic manner (SALS). Mutations in four major genes, SOD1, TARDBP, FUS and the intronic C9orf72 GGGGCC expansion account for approximately 50% of FALS. A recent report by Bannwarth et al. (2014) described a novel p.Ser59Leu (c.176C>T) mutation in CHCHD10accounting forALS and frontotemporal dementia (FTD). Subsequent independent screenings have also confirmed a putative role of CHCHD10 in a broad range of neurodegenerative diseases(Auranen et al., 2015; Johnson et al., 2014; Kurzwelly et al., 2015; Penttila et al., 2015; Zhang et al., 2015)(Supplementary Table 1).Here we report the first mutation screening of CHCHD10in a UK cohort of familial and sporadic patients.

  1. Methods

All 4 coding exons of CHCHD10(NM_213720.2) were amplified by PCR and products directly sequenced with an ABI3130 (Applied Biosystems, Warrington, UK) (Supplementary Information).

  1. Results

Analysis of an existing in-house cohort of UK FALS exomes revealed poor coverage (only 24.8% of samples met the minimum read depth ie. 8x) across exon 2 of CHCHD10 that is a hotspot for reported mutations. We therefore Sanger sequenced all exons of CHCHD10 in 163 FALS, 262 SALS and 576 healthy controls to ensure complete coverage of the gene. We identified thepreviously described p.Pro34Ser(c.100C>T) variant in 1 FALS (0.61%), 4 SALS (1.53%) and 8 controls (1.39%). One of the sporadic cases also carried theC9orf72 hexanucleotide expansion. Further SNP genotyping of position 100 in additional UK controlsdetected the minor allele, thymine, in3/640 (0.31%) individuals. In line with Zhang et al. (2015) and Dobson-Stone et al. (2015), our screening results identified that the P34S frequency was non-significant in ALS cases versus controls (ALS/FTD n=5/425, 1.2% vs controls n=11/1,216, 0.82%) (p=0.58, 2-tailed Fischer’s exact test). Additionally, several other CHCHD10 variants were identified, however none were predicted to be pathogenic as they were either found only in controls, or were insufficiently rare in ExAC (Supplementary Table 2). None of the changes were predicted by Netgene2 ( to alter splicing.

  1. Discussion

Our study failed to identify any disease-relevant variants, suggesting that mutations in CHCHD10 are not a common cause in UK ALS/FTD patients.ThePro34Ser variant was initially identified in two unrelated French FTD-ALS individuals (Chaussenot et al., 2014) and one Italian sporadic case (Ronchi et al., 2015). However in anAustralian cohort of FTD and/or dementia patients (n=370), seven cases as well as nine aged controls (n=807) were found to carry the Pro34Ser change, suggesting that it is non-contributory to disease (p=0.290)(Dobson-Stone et al., 2015). Although this variant is absent in dbSNP ( and EVS ( it is found nine times in the Non-Finnish European subset of the Exome Aggregation Consortium data at a frequency of 0.60% (n=1,508) (ExAC, It is worth noting that the coverage of exon 2 at a read depth of at least 10x is relatively low (47.10%) with only 8.88% of samples achieving this thresholdat Pro34 (ExAC release 1)potentiallydue to the GC-rich nature of this region (77.3% GC-content). The low coverage from next generation sequencing suggests that the true frequency of variants in controls may indeed be higher, as reflected by our Sanger sequencing data. Low coverage of exome sequencing reads from public databases is a note of caution when interpreting newly identified variants.

To date, there has been an absence of published in-vitro studies investigating the functional impact of ALS-associated CHCHD10 mutations with the exception of the Ser59Leuchange. Based on impact prediction tools and conservation of the codon, the Pro34Ser variant is predicted to influence the protein’s stability and/or protein-protein interactions (Chaussenot et al., 2014). One sporadic case from our cohort carried botha C9orf72hexanucleotide repeat expansion and aPro34Ser changeas seen byDobson-Stone et al. (2015).Several studies have reported double mutations in ALS or FTD associated genes, suggesting an oligogenic model requiring multiple ‘hits’ to manifest disease(King et al., 2013; van Blitterswijk et al., 2013; van Blitterswijk et al., 2012). Together, these results suggest that the Pro34Ser variant is not pathogenic as the primary cause of disease, and its potential role as a susceptibility allele may be questionable. Functional investigationis essential to critically assess the contribution of CHCHD10as a causative gene in ALS pathobiology as well as other neurodegenerative phenotypes.

Acknowledgments

Funding for this work was provided by The Middlemass family, Heaton-Ellis Trust, Motor Neurone Disease Association, Medical Research Council , The Psychiatry Research Trust of the Institute of Psychiatry, Guy’s and St Thomas’ Charity, the Wellcome Trust and the Noreen Murray Foundation. This is an EU Joint Programme - Neurodegenerative Disease Research (JPND) project. The project is supported through the following funding organisations under the aegis of JPND - (United Kingdom, Medical Research Council and Economic and Social Research Council). CES and AAC receive salary support from the National Institute for Health Research (NIHR) Dementia Biomedical Research Unit at South London and Maudsley NHS Foundation Trust andKing’s College London. The views expressed are those of the authors and not necessarily those of the NHS, the NIHR or the Department of Health. The work leading up to this publication was funded by the European Community’s Health Seventh Framework Programme (FP7/2007–2013; grant agreement number 259867). Samples used in this research were in part obtained from the UK National DNA Bank for MND Research, funded by the MND Association and the Wellcome Trust. We would like to thank people with MND and their families for their participation in this project. We acknowledge sample management undertaken by Biobanking Solutions funded by the Medical Research Council at the Centre for Integrated Genomic Medical Research, University of Manchester.

Conflicts of interest: none

The CHCHD10 P34S variant is not associated with ALS in a UK cohort of familial and sporadic patients, SUPPLEMENTARY

Methods

(1)Samples

A total of 163 familial (including 1 ALS-FTD) and 262 sporadic ALS cases (including 34 ALS-FTD) including 24 C9orf72 hexanucleotide expansion carriers were included in this study. These cases were devoid of mutations in SOD1, TARDBP, FUS, VCP, UBQLN2, MATR3, TUBA4A, TBK1 and PFN1. All patients met full El-Escorial criteria for ALS and gave consent for research purposes.576 local UK controls were screened in exon 2 of CHCHD10 by direct sequencing of PCR products. An additional 640 controls were screened at position 100 of the cDNA molecule by Kaspar Genotyping (outsourced to LGC Genomics,Hoddesdon, UK).

(2)Polymerase chain reaction and sequencing

All 4 exons of CHCHD10 (NM_213720.2) were amplified by PCR. Primers were designed to amplify both exonic sequence and at least 100 base pairs of the surrounding introns.

PCR primers for amplification and Sanger sequencing (5’-3’)

Exon / Forward Primer / Reverse Primer / Sanger Sequencing Primer / Annealing Temperature (°C)
1 / gatagggttggggcagt / ggaagcctgcctctaagtga / cagcagccaaggtcactct / 57.6
2 / gatagggttggggcagt / ggaagcctgcctctaagtga / gtgggtcgtccatctctcc / 57.6
3 / cagcagaaacatgctgtctgta / ttccaatcccagctatctgg / ctggatcactcagcctgcct / 50.5
4 / cagcagaaacatgctgtctgta / ttccaatcccagctatctgg / agaggccaaccctcctctt / 50.5

PCR was performed with a Taq PCRx DNA Polymerase kit according to manufacturer’s instructions from Life Technologies (Paisley, UK) (catalogue number 11508-017) to address the high GC content of exon 2. PCR products were directly sequenced on an ABI3130 Genetic Analyser and chromatograms analysed by eye with Sequencer V5 software (GeneCodes Pty Ltd, Ann Arbor USA).

Supplementary Table Legends

Supplementary Table 1. A summary of published CHCHD10 (Refseq NM_213720.2) mutation screening studies. The broad range of associated phenotypes includes pure ALS, pure FTD, ALS-FTD, mitochondrial myopathy, late-onset spinal motor neuropathy, axonal Charcot-Marie-Tooth type 2, Parkinson’s disease, Alzheimer’s disease, and early-onset dementia.

Supplementary Table 2.CHCHD10 variants identified in this study (Refseq NM_213720.2).

Phenotype / Variant / Population / Carriers (n) / Families (n) / Frequency (%) / References
Pure ALS / p.R15L (c.44G>T) / US / 6 / 3 / 3/85 (3.5%) / Johnson et al. (2014)
Canadian / 1 / 1 / 1/498 (0.2%) / Zhang et al. (2015)
German / 8 / 2 / 2/128 (1.6%) / Muller et al. (2014)
German / 4 / 1 / NA / Kurzwelly et al. (2015)
p.G66V (c.197G>T) / Finnish / 1 / 1 / 1/128 (0.7%) / Muller et al. (2014)
p.P80L (c.239C>T) / Italian / 2 / 2 / 2/224 (0.9%) / Ronchi et al. (2015)
German/Dutch / 2 / 2 / 2/498 (0.4%) / Zhang et al. (2015)
p.P34S (c.100C>T) / Italian / 3 / 3 / 3/228 (1.3%) / Chio et al. (2015)
Italian / 1 / 1 / 1/224 (0.4%) / Ronchi et al. (2015)
Pure FTD / p.P23T (c.67C>A) / Italian / 1 / 1 / 1/498 (0.2%) / Zhang et al. (2015)
p.A35D (c.104C>A) / Italian / 2 / 1 / 1/498 (0.2%) / Zhang et al. (2015)
ALS-FTD / p.S59L (c.176C>T) / Spanish / 8 / 1 / NA / Bannwarth et al. (2014)
French / 1 / 1 / 1/115 (0.9%) / Chaussenot et al. (2014)
p.P34S (c.100C>T) / French / 2 / 2 / 2/115 (1.7%) / Chaussenot et al. (2014)
Australian / 2 / 2 / 2/16 (12.5%) / Dobson-Stoneet al. (2015)
Mitochondrial myopathy / p.R15S (c.43C>A)
p.G58R (c.172G>C) / Puerto Rican / 10 / 1 / NA / Ajroud-Driss et al. (2015)
Late-onset spinal motor neuropathy / p.G66V (c.197G>T) / Finnish / 55 / 17 / NA / Penttila et al. (2015)
Axonal Charcot-Marie-Tooth Type 2 / p.G66V (c.197G>T) / Finnish / 12 / 6 / 6/126 (4.8%) / Auranen et al. (2015)
Parkinson’s disease / p.P34S (c.100C>T) / Norwegian / 1 / 1 / 1/498 (0.2%) / Zhang et al. (2015)
Alzheimer’s disease / p.P34S (c.100C>T) / Canadian / 2 / 2 / 2/498 (0.4%) / Zhang et al. (2015)
Early-onset dementia / p.P34S (c.100C>T) / Australian / 5 / 5 / 5/132 (3.8%) / Dobson-Stone et al. (2015)

Supplementary Table 1.

Supplementary Table 2

Exon / Genome Position / Variant / Change / Case Frequency (%) / Control Frequency (%) / dbSNP142 / ExAC Frequencies
(Non-Finnish Europeans)
2 / chr22:24109774 / p.P16P (c.48A>C) / Synonomous / 70/425 (16.47%) / 76/576 (13.19%) / rs179468 / 51/56 (91.07%)
2 / chr22:24109722 / p.P34S (c.100C>T) / Nonsynonomous / 5/425(1.18%) / 5/576 (0.87%) / - / 9/1,508 (0.60%)
2 / chr22:24109660 / p.G54G (c.162G>C) / Synonomous / 0/425 (0.00%) / 1/576 (0.17%) / - / 2/28,582 (0.01%)
2 / chr22:24109654 / p.A56A (c.168C>G) / Synonomous / 1/425 (0.24%) / 1/576 (0.17%) / rs13053635 / -
2 / chr22:24109652 / p.V57E (c.170T>A) / Synonomous / 0/425 (0.00%) / 1/576 (0.17%) / - / -
2 / chr22:24109588 / p.S78S (c.234G>A) / Synonomous / 9/425 (2.12%) / 11/576 (1.91%) / rs111527940 / 650/49,480 (1.31%)
3 / chr22:24108450 / p.A92P (c.274G>C) / Nonsynonomous / 1/425(0.24%) / 0/576 (0.00%) / rs374353973 / 10/3,416 (0.29%)

References

Auranen, M., Ylikallio, E., Shcherbii, M., Paetau, A., Kiuru-Enari, S., Toppila, J.P., Tyynismaa, H. 2015. CHCHD10 variant p.(Gly66Val) causes axonal Charcot-Marie-Tooh disease. Neurology Genetics. doi:10.1212/NXG.0000000000000003.

Bannwarth, S., Ait-El-Mkadem, S., Chaussenot, A., Genin, E.C., Lacas-Gervais, S., Fragaki, K., Berg-Alonso, L., Kageyama, Y., Serre, V., Moore, D.G., Verschueren, A., Rouzier, C., Le Ber, I., Auge, G., Cochaud, C., Lespinasse, F., N'Guyen, K., de Septenville, A., Brice, A., Yu-Wai-Man, P., Sesaki, H., Pouget, J., Paquis-Flucklinger, V. 2014. A mitochondrial origin for frontotemporal dementia and amyotrophic lateral sclerosis through CHCHD10 involvement. Brain 137(Pt 8), 2329-45. doi:10.1093/brain/awu138.

Chaussenot, A., Le Ber, I., Ait-El-Mkadem, S., Camuzat, A., de Septenville, A., Bannwarth, S., Genin, E.C., Serre, V., Auge, G., French research network on, F.T.D., Ftd, A.L.S., Brice, A., Pouget, J., Paquis-Flucklinger, V. 2014. Screening of CHCHD10 in a French cohort confirms the involvement of this gene in frontotemporal dementia with amyotrophic lateral sclerosis patients. Neurobiology of aging 35(12), 2884 e1-4. doi:10.1016/j.neurobiolaging.2014.07.022.

Dobson-Stone, C., Shaw, A.D., Hallupp, M., Bartley, L., McCann, H., Brooks, W.S., Loy, C.T., Schofield, P.R., Mather, K.A., Kochan, N.A., Sachdev, P.S., Halliday, G.M., Piguet, O., Hodges, J.R., Kwok, J.B. 2015. Is CHCHD10 Pro34Ser pathogenic for frontotemporal dementia and amyotrophic lateral sclerosis? Brain : a journal of neurology. doi:10.1093/brain/awv115.

Johnson, J.O., Glynn, S.M., Gibbs, J.R., Nalls, M.A., Sabatelli, M., Restagno, G., Drory, V.E., Chio, A., Rogaeva, E., Traynor, B.J. 2014. Mutations in the CHCHD10 gene are a common cause of familial amyotrophic lateral sclerosis. Brain : a journal of neurology 137(Pt 12), e311. doi:10.1093/brain/awu265.

King, A., Al-Sarraj, S., Troakes, C., Smith, B.N., Maekawa, S., Iovino, M., Spillantini, M.G., Shaw, C.E. 2013. Mixed tau, TDP-43 and p62 pathology in FTLD associated with a C9ORF72 repeat expansion and p.Ala239Thr MAPT (tau) variant. Acta neuropathologica 125(2), 303-10. doi:10.1007/s00401-012-1050-0.

Kurzwelly, D., Kruger, S., Biskup, S., Heneka, M.T. 2015. A distinct clinical phenotype in a German kindred with motor neuron disease carrying a CHCHD10 mutation. Brain : a journal of neurology. doi:10.1093/brain/awv014.

Penttila, S., Jokela, M., Bouquin, H., Saukkonen, A.M., Toivanen, J., Udd, B. 2015. Late onset spinal motor neuronopathy is caused by mutation in CHCHD10. Annals of neurology 77(1), 163-72. doi:10.1002/ana.24319.

Ronchi, D., Riboldi, G., Del Bo, R., Ticozzi, N., Scarlato, M., Galimberti, D., Corti, S., Silani, V., Bresolin, N., Comi, G.P. 2015. CHCHD10 mutations in Italian patients with sporadic amyotrophic lateral sclerosis. Brain : a journal of neurology. doi:10.1093/brain/awu384.

van Blitterswijk, M., Baker, M.C., DeJesus-Hernandez, M., Ghidoni, R., Benussi, L., Finger, E., Hsiung, G.Y., Kelley, B.J., Murray, M.E., Rutherford, N.J., Brown, P.E., Ravenscroft, T., Mullen, B., Ash, P.E., Bieniek, K.F., Hatanpaa, K.J., Karydas, A., Wood, E.M., Coppola, G., Bigio, E.H., Lippa, C., Strong, M.J., Beach, T.G., Knopman, D.S., Huey, E.D., Mesulam, M., Bird, T., White, C.L., 3rd, Kertesz, A., Geschwind, D.H., Van Deerlin, V.M., Petersen, R.C., Binetti, G., Miller, B.L., Petrucelli, L., Wszolek, Z.K., Boylan, K.B., Graff-Radford, N.R., Mackenzie, I.R., Boeve, B.F., Dickson, D.W., Rademakers, R. 2013. C9ORF72 repeat expansions in cases with previously identified pathogenic mutations. Neurology 81(15), 1332-41. doi:10.1212/WNL.0b013e3182a8250c.

van Blitterswijk, M., van Es, M.A., Hennekam, E.A., Dooijes, D., van Rheenen, W., Medic, J., Bourque, P.R., Schelhaas, H.J., van der Kooi, A.J., de Visser, M., de Bakker, P.I., Veldink, J.H., van den Berg, L.H. 2012. Evidence for an oligogenic basis of amyotrophic lateral sclerosis. Human molecular genetics 21(17), 3776-84. doi:10.1093/hmg/dds199.

Zhang, M., Xi, Z., Zinman, L., Bruni, A.C., Maletta, R.G., Curcio, S.A., Rainero, I., Rubino, E., Pinessi, L., Nacmias, B., Sorbi, S., Galimberti, D., Lang, A.E., Fox, S., Surace, E.I., Ghani, M., Guo, J., Sato, C., Moreno, D., Liang, Y., Keith, J., Traynor, B.J., St George-Hyslop, P., Rogaeva, E. 2015. Mutation analysis of CHCHD10 in different neurodegenerative diseases. Brain : a journal of neurology. doi:10.1093/brain/awv082.