______’s Notes
(Place name above)
Protein Synthesis & MutationsChapter 13
The Central Dogma of Biology:
Protein Synthesis
RNA Structure:
1. It is a nucleic acid.
2. It is made of monomers called nucleotides
3. There are two differences between a DNA & an RNA nucleotide:
- RNA has ______instead of deoxyribose
- RNA has the base ______instead of Thymine
- it still has A, C, & G
- ______will pair with ______(Uracil is a pyrimidine)
Protein Synthesis
Types of RNA:
1. ______(mRNA)
- carries the info from DNA to the ribosome
- contains “______” that code for individual amino acids
2. ______(rRNA)
- a component of the ribosome
3. ______(tRNA)
- “Transfers” the info on the mRNA to an amino acid sequence (protein).
- contains “______” that complement the codons on mRNA.
Protein Synthesis
What is transcription?
______
- All forms of RNA are made using this process.
- The process is similar to replication.
Protein Synthesis
The Steps of Replication:
1. ______:
RNA polymerase binds to a location on the DNA called a
______
- Promoters signal the beginning of a gene.
-RNA polymerase has the ability to unzip
the DNA.
Protein Synthesis
The Steps of Replication:
2. ______:
RNA polymerase makes a complementary RNA strand from one of the exposed DNA strands.
- This DNA strand is called the “______.”
Protein Synthesis
The Steps of Replication:
3. ______:
RNA polymerase comes across a DNA
sequence called a “______”
and stops the transcription process.
Protein Synthesis
Eukaryotic mRNA Transcripts must be
edited.
- The original mRNA contains sequences
known as introns exons.
______= sequences that do not code for anything.
______= sequences that actually code for a protein.
2. The introns are cut out and the exons are spliced together.
3. A ______sequence & a ______sequence are added and the mRNA is ready
to go.
Protein Synthesis
The Genetic Code:
1. The sequence of the DNA bases “codes” for the individual amino acids in a protein.
2. This code is copied on to an mRNA strand.
3. The mRNA code:
- 3 mRNA bases in a row are called a ______& each
codes for a particular amino acid.
4. Because there are 4 RNA bases, there are 64 different 3-base combinations.
- One combination is known as the “______” (AUG).
This marks the beginning of the protein.
- Three of them are “______” (UAA, UAC,
UGA). These codons do not cods for any amino acids, thus signaling
the end of the protein.
Protein Synthesis
What is the amino acid sequence from the following mRNA sequence?
AUGGUCGAUAAACCACGCCUGUGA
______
Protein Synthesis
What is Translation?
______
______
Ribosome Structure:
1. Has two subunits: small & large
2. Large subunit has two sites:
______(polypeptide site)
______(amino acid site)
Protein Synthesis
Mutations
What is a mutation?
______
- Mutations cause the amino acid sequence to be incorrect.
-An incorrect amino acid sequence usually causes the protein to be nonfunctional or it gives the protein new functions.
-A change in amino acid sequence often causes a change in shape, thus a change in function.
Types of Mutations
1. Gene Mutations (a.k.a. ______)
These affect a particular gene only.
- ______– replace one base with another.
- affects only ______amino acid in the protein.
- May not even cause a problem
(______).
B. ______– a new base is placed in the sequence;
this alters the reading frame & every amino acid after the
mutation is altered.
C. ______– a base is removed & every amino acid
after this mutation is altered.
______are called ______mutations.
Types of Mutations
2. Chromosomal Mutations – affect whole chromosomes
A. ______– part of the chromosome disappears
B. ______– part of the chromosome is copied.
C. ______– the sequence of genes on the chromosome is partially
flipped.
D. ______– part of one chromosome is removed and placed onto a different chromosome
E. ______– parts of two chromosomes are clipped off & switch
places.