TEL/ETV6 CONTROLS MAINTENANCE of HEMATOPOIETIC STEM CELLS (Hscs) and MEGAKARYOCYTE DEVELOPMENT

Supplement to “ Tel/Etv6 is an essential and selective regulator of adult hematopoietic stem cell survival” 1..

Supplementary Methods and References

Mice. All mice were housed in the animal facility at Children’s Hospital and were cared for according to the guidelines and through the supervision of the Animal Resources of Children’s Hospital (ARCH). Cre-mediated excision in the germline was achieved using Gata1-Cre transgenic mice (CD1/Swiss-Webster background, (Mao et al. 1999)1) and resulted in the generation of a mouse strain that harboured the excised form of the Tel/Etv6 allele exclusively (and thus could be maintained in the heterozygous state only). Gata1-Cre transgenic mice also gave rise to progeny (~5-10%) with megakaryocyte/erythroid specific excision (Fig. 2Cc). CD19-Cre knock-in mice (Rickert et al. 1997)2, Lck-Cre transgenic mice (Hennet et al. 1995)3, and Mx1-Cre mice (Kuhn et al. 1995)4 and Tel/Etv6 floxed mice were all maintained in mixed C57/BL6x129sv background.

Generation of proB cell lines, retroviral gene transfer, and proliferation assays. Long-term culture conditions described by Whitlock and Witte were used to grow B-lineage cells from bone marrow cells of homozygous floxed mice ex vivo (Whitlock and Witte 1982)5. Cell lines were derived after harvesting cells in suspension and transferring them onto ST-2 stromal cells (Hardy et al. 1987)6 in the presence of IL-7. Cell-lines were cloned by limiting in 96-well plates, FACS analysis was performed to confirm proB-cell phenotype (S7+, IgM-), and dependence on both IL-7 and feeder cells was confirmed by selective withdrawal of each (not shown). Tel/Etv6 was excised by infection with a GFP/Cre fusion protein (Gagneten et al. 1997)7 expressed by the VSV-G pseudotyped retroviral vector CMMP (Klein et al. 2000)8using the identical vector expressing EGFP only as a control. Clones, growing in 10 cm petri-dishes with IL-7 and ST-2, were infected using 50 l concentrated viral supernatant (CMMP-EGFP or CMMP-GFP/Cre; titers ~109) and 8 g/ml polybrene for 1 hour at 0C, followed by 12 hours at 37C in 5%CO2. Subsequently, flourescent clones were FACS-sorted twice to obtain pure populations of infected cells. For Western blot analysis proB-cells were lysed in triton buffer (1%Triton X 100/50mM Tris pH 7.5/ 50mM NaCl/ 2mM EDTA/Proteinase inhibitor cockail, Boehringer Mannheim), subjected to electrophoresis, blotted and Tel/Etv6 was visualized using an N-terminal antiserum and the ECL analysis system (Pharmacia). DNA synthesis assays were performed as described (Hock et al. 1991)9 with modifications. Briefly, pro B-cells (2x104) were grown for 72 hours in flat bottom 96 well plates that had been seeded one day previously with 4x104 irradiated (3000 cGy) ST-2 feeder cells. 3H-thymidine (Amersham) was added during the last 4 hours of culture, DNA was harvested on filters and incorporation was quantified by scintillation counting. Murine IL-7, murine IFN and murine IFN were purchased from R+D.

Colony assays. Megakaryocyte colonies were generated using the Megacult-C megakaryocyte progenitor kit (Stem Cell Technologies) according to the manufacturers instructions. Other colony assays were performed using Methocult M3234 (Stem Cell Technologies). Bone marrow cells were seeded into 35 mm2 petri-dishes in triplicate and incubated in 5% CO2 at 37C with the appropriate cytokines (RD Systems) (Erythroid colonies, 2 x 105, EPO, KL; myeloid colonies (2 x 104, IL-3, GM-CSF; B–cell colonies, 4 x 105 , IL-7). High Proliferative Potential colonies (HPPCs) were generated in SCF, IL-3, EPO, IL-6, IL-1, GM-CSF and M-CSF and defined as colonies with a tight center and a diameter  1mm at day 12 (Chang et al. 2000)10. For determination of excision status colonies were isolated using a capillary under an inverted microscope, pooled and processed for DNA extraction. Competitive PCR was used to assess excision status of the floxed allele as shown in Supplementary Fig. 4Cc with primers: TTCCATGTGTTACCTCTGTCCG (5’ to first loxP site); ACTGAACTGAGTTCTGCTGAC ACTGAACTGAGTTCTGCTGAG (antisense, 3’ to first loxP site); ACCACACCAGTTGGTCATGAA (antisense 3’ to last loxP site) and the following conditions: denaturation-94C, 1’; Annealing-57C, 1’;extension 72C-1’; 35cycles).

References

Chang, H., L.A. Jensen, P. Quesenberry, and I. Bertoncello. 2000. Standardization of hematopoietic stem cell assays: a summary of a workshop and working group meeting sponsored by the National Heart, Lung, and Blood Institute held at the National Institutes of Health, Bethesda, MD on September 8-9, 1998 and July 30, 1999. Exp Hematol 28: 743-52.

Gagneten, S., Y. Le, J. Miller, and B. Sauer. 1997. Brief expression of a GFP cre fusion gene in embryonic stem cells allows rapid retrieval of site-specific genomic deletions. Nucleic Acids Res 25: 3326-31.

Hardy, R.R., T. Kishimoto, and K. Hayakawa. 1987. Differentiation of B cell progenitors in vitro: generation of surface IgM+ B cells, including Ly-1 B cells, from Thy-1- asialoGM1+ cells in newborn liver. Eur J Immunol 17: 1769-74.

Hennet, T., F.K. Hagen, L.A. Tabak, and J.D. Marth. 1995. T-cell-specific deletion of a polypeptide N-acetylgalactosaminyl-transferase gene by site-directed recombination. Proc Natl Acad Sci U S A 92: 12070-4.

Hock, H., M. Dorsch, T. Diamantstein, and T. Blankenstein. 1991. Interleukin 7 induces CD4+ T cell-dependent tumor rejection. J Exp Med 174: 1291-8.

Klein, C., H. Bueler, and R.C. Mulligan. 2000. Comparative analysis of genetically modified dendritic cells and tumor cells as therapeutic cancer vaccines. J Exp Med 191: 1699-708.

Kuhn, R., F. Schwenk, M. Aguet, and K. Rajewsky. 1995. Inducible gene targeting in mice. Science 269: 1427-9.

Mao, X., Y. Fujiwara, and S.H. Orkin. 1999. Improved reporter strain for monitoring Cre recombinase-mediated DNA excisions in mice. Proc Natl Acad Sci U S A 96: 5037-42.

Rickert, R.C., J. Roes, and K. Rajewsky. 1997. B lymphocyte-specific, Cre-mediated mutagenesis in mice. Nucleic Acids Res 25: 1317-8.

Whitlock, C.A. and O.N. Witte. 1982. Long-term culture of B lymphocytes and their precursors from murine bone marrow. Proc Natl Acad Sci U S A 79: 3608-12.

1.Mao, X., Fujiwara, Y. & Orkin, S. H. Improved reporter strain for monitoring Cre recombinase-mediated DNA excisions in mice. Proc Natl Acad Sci U S A 96, 5037-42 (1999).

2.Rickert, R. C., Roes, J. & Rajewsky, K. B lymphocyte-specific, Cre-mediated mutagenesis in mice. Nucleic Acids Res 25, 1317-8 (1997).

3.Hennet, T., Hagen, F. K., Tabak, L. A. & Marth, J. D. T-cell-specific deletion of a polypeptide N-acetylgalactosaminyl-transferase gene by site-directed recombination. Proc Natl Acad Sci U S A 92, 12070-4 (1995).

4.Kuhn, R., Schwenk, F., Aguet, M. & Rajewsky, K. Inducible gene targeting in mice. Science 269, 1427-9 (1995).

5.Whitlock, C. A. & Witte, O. N. Long-term culture of B lymphocytes and their precursors from murine bone marrow. Proc Natl Acad Sci U S A 79, 3608-12. (1982).

6.Hardy, R. R., Kishimoto, T. & Hayakawa, K. Differentiation of B cell progenitors in vitro: generation of surface IgM+ B cells, including Ly-1 B cells, from Thy-1- asialoGM1+ cells in newborn liver. Eur J Immunol 17, 1769-74. (1987).

7.Gagneten, S., Le, Y., Miller, J. & Sauer, B. Brief expression of a GFP cre fusion gene in embryonic stem cells allows rapid retrieval of site-specific genomic deletions. Nucleic Acids Res 25, 3326-31 (1997).

8.Klein, C., Bueler, H. & Mulligan, R. C. Comparative analysis of genetically modified dendritic cells and tumor cells as therapeutic cancer vaccines. J Exp Med 191, 1699-708 (2000).

9.Hock, H., Dorsch, M., Diamantstein, T. & Blankenstein, T. Interleukin 7 induces CD4+ T cell-dependent tumor rejection. J Exp Med 174, 1291-8 (1991).

10.Chang, H., Jensen, L. A., Quesenberry, P. & Bertoncello, I. Standardization of hematopoietic stem cell assays: a summary of a workshop and working group meeting sponsored by the National Heart, Lung, and Blood Institute held at the National Institutes of Health, Bethesda, MD on September 8-9, 1998 and July 30, 1999. Exp Hematol 28, 743-52 (2000).