Supplementary Information

Functional characterization of a vanillin dehydrogenase in Corynebacterium glutamicum

Wei Ding1#, Meiru Si1,2#, Weipeng Zhang1, Yaoling Zhang1, Can Chen1,2, Lei Zhang1,2, Zhiqiang Lu3, Shaolin Chen2& Xihui Shen1, 2*

1 State Key Laboratory of Crop Stress Biology for Arid Areas and College of Life Sciences, Northwest A&F University, Yangling, Shaanxi 712100, PR China;

2 Biomass Energy Center for Arid and Semi-Arid Lands, Northwest A&F University, Yangling, Shaanxi 712100, PR China;

3 College of Plant Protection, Northwest A&F University, Yangling, Shaanxi 712100, PR China.

Running title: Vanillin dehydrogenase in Corynebacterium glutamicum

# These authors contributed equally to this work.

* Corresponding author

E-mail address: (X.H. Shen)

Key Words: Corynebacterium glutamicum; Vanillin dehydrogenase; Site-directed mutagenesis; Aromatic compound

Figure S1 Multiple sequence alignment of VDHATCC13032 with identified VDHs and aldehyde dehydrogenases from other sources. The amino acid sequence of the VDH from C. glutamicum ATCC13032 was aligined to the amino acid sequence of the VDHs from Amycolatopsis sp. ATCC 39117, R. jostii RHA1, S. paucimobilis SYK6, and the amino acid sequence of the betaine aldehyde dehydrogenase from Pseudomonas aeruginosa DK2, the amino acid sequence of the aldehyde dehydrogenase from hyperthermophilic archaeon Sulfolobus tokodaii. And the site-directed residues were marked in black.

Table S1 Substrate specificity of VDH.

Substrates / Relative activity (%)
vanillin / 100
3, 4-dihydroxybenzaldehyde / 90.29
p-hydroxylbenzaldehyde / 89.04
3-hydroxylbenzaldehyde / 81.59
p-nitrobenzaldehyde / 75.80
terephthalaldehyde / 56.67
o-phthaldialdehyde / 28.37
2,4-dichlorobenzaldehyde / 55.93
cinnamaldehyde / 24.40
syringaldehyde / 23.31
benzaldehyde / 37.93
phenylacetaldehyde / 2.13
benzenepropanal / 31.22
formaldehyde / 4.27
aldehyde / 3.11

VDH activity was determined according to the methods with substrate (1 mM), NAD+ (0.5 mM) and an appropriate amount of enzyme in potassium phosphate buffer (100 mM, pH 7.0), respectively. The activity was expressed as the percentage of the activity toward 1 mM vanillin.

Table S2 Kinetics parameters of VDH towards vanillin, 3,4-dihydroxybenzaldehyde and p-hydroxylbenzaldehyde.

Substrates / Km(μM) / kcat(s-1) / kcat/Km (s-1μM-1)
vanillin / 26.31±3.09 / 21.03±1.22 / 0.80±0.04
3,4-dihydroxybenzaldehyde / 30.44±4.11 / 23.42±1.78 / 0.77±0.04
p-hydroxylbenzaldehyde / 39.11±4.89 / 22.92±1.80 / 0.59±0.02

The kinetics parameters were determined according to the standard enzyme assay procedure with 0.5 mM NAD+ and different concentrations of 3,4-dihydroxybenzaldehyde, p-hydroxylbenzaldehyde and vanillin by means of respective Lineweaver-Burk plots. The concentrations were five values ranging from 0.2 to 1 mM for substrates.

Table S3 Kinetics parameters of VDH toward NAD+ and NADP+.

Substrates / NAD+ / NADP+
Km (μM) / kcat(s-1) / kcat/Km
(s-1μM -1) / Km(μM) / kcat(s-1) / kcat/Km
(s-1μM -1)
vanillin / 26.25±3.22 / 17.88±1.92 / 0.68±0.01 / 28.31±3.43 / 0.765±2.22 / 1.62±0.11
3,4-dihydroxy benzaldehyde / 31.33±4.06 / 19.62±1.86 / 0.63±0.02 / 35.28±4.27 / 0.827±2.52 / 1.41±0.09
p-hydroxyl benzaldehyde / 33.41±4.15 / 20.46±2.16 / 0.61±0.01 / 37.40±4.36 / 0.906±3.00 / 1.45±0.08

The kinetics parameters were determined according to the standard enzyme assay procedure with 1 mM 3,4-dihydroxy benzaldehyde, p-hydroxyl benzaldehyde and vanillin by means of respective Lineweaver-Burk plots. The concentrations were five values ranging from 0.125 to 1 mM for NAD+ or 0.125 to 2.5 mM for NADP+.

Table S4 Relative activity of VDH and its mutants.

Relative activity (%)
NAD+ / NADP+
WT / 100 / 100
N157A / 48.02 / 9.11
K180A / 35.15 / 9.96
E199A / 49.12 / 78.01
E258A / 44.06 / 23.97
C292A / 33.79 / 6.53

VDH activity was determined according to the methods with vanillin (3 mM), NAD+ (1 mM) (or NADP+ (2.5 mM)) and an appropriathe amount of enzyme in potassium phosphate buffer (100 mM , pH 7.0). The activity was expressed as the percentage of the activity toward wild type. (100%, 0. 689±0.026 U/mg).

Table S5 Kinetics parameters of VDH toward NAD+ and NADP+.

NAD+ / NADP+
Mutants / Km(μM) / kcat(s-1) / kcat/Km
(s-1μM-1) / Km(μM) / kcat(s-1) / kcat/Km
(s-1μM-1)
WT / 20.36±3.65 / 12.96±1.32 / 0.64±0.04 / 22.36±3.01 / 49.80±1.86 / 2.23±0.19
N157A / 98.79±7.53 / 8.94±0.96 / 0.09±0.01 / 242.29±10.11 / 20.14±0.90 / 0.08±0.01
K180A / 90.33±7.36 / 12.54±1.08 / 0.14±0.01 / 256.37±21.36 / 54.66±1.38 / 0.21±0.01
E199A / 103.29±6.01 / 6.30±0.61 / 0.06±0.01 / 61.23±4.29 / 46.92±0.78 / 0.77±0.04
E258A / 70.19±5.25 / 10.26±0.66 / 0.15±0.01 / 114.33±9.48 / 13.20±1.26 / 0.12±0.01
C292A / 88.95±6.35 / 5.76±0.42 / 0.06±0.01 / 148.40±12.32 / 12.72±1.20 / 0.09±0.01

The kinetics parameters were determined according to the standard enzyme assay procedure with 3 mM vanillin by means of respective Lineweaver-Burk plots. The concentrations were five values ranging from 0.125 to 1 mM for NAD+ or 0.125 to 2.5 mM NADP+.

Table S6 Kinetics parameters of VDH toward vanillin.

Mutants / Km(μM) / kcat(s-1) / kcat/Km(s-1μM-1)
WT / 31.36±5.56 / 44.04±2.34 / 1.40±0.15
N157A / 73.28±10.38 / 24.30±1.68 / 0.33±0.02
K180A / 157.46±35.15 / 21.66±1.50 / 0.14±0.02
E199A / 45.89±4.48 / 39.72±2.34 / 0.87±0.03
E258A / 114.21±25.01 / 15.90±1.26 / 0.12±0.02
C292A / 273.88±41.33 / 16.68±1.50 / 0.06±0.01

The kinetics parameters were determined according to the standard enzyme assay procedure with 1 mM NAD+ by means of respective Lineweaver-Burk plots. The concentrations were five values ranging from 0.2 to 3 mM for vanillin.

Table S7 Bacterial strains and plasmids used in this study.

Strains and plasmids / Relevant characteristics / Sources
Strains
Escherichia coli
JM109 / recAl supE44 endAI hsdR17 gyrA96 relA1 thi Δ(lac-proAB) / Stratagene
BL21(DE3) / hsdS gal (λcIts857 ind-l Sam7 nin-5 lacUV5-T7 gene 1) / Novagen
Corynebacterium glutamicum
RES167 / Restriction-deficient mutant of ATCC 13032;Δ(cglIM-cglIR-cglIIR) / This study
RES167Δncgl2578 / ncgl2578 deleted in RES167 / This study
Plasmids
pK18mobsacB / Mobilizable vector, allows for selection of double crossover in C. lutamicum / Schäfer et al.1
pK18mobsacBΔncgl2578 / Construct used for in-frame deletion of ncgl2578 / This study
pXMJ19 / Shuttle vector (Ptac lacIq pBL1 oriVC. glutamicum pK18 oriVE. coli) / Jakoby
pXMJ19-ncgl2578 / ncgl2578 cloned into pXMJ19 for complementation / This study
pET28a / Experssion vector with N-terminal hexahistidine affinity tag / Novagen
pET28a-ncgl2578 / pET28a derivative for expression of ncgl2578 / This study

Table S8 Bacterial strains, plasmids and primers used in this study.

Primers
Ncgl2578upFBamHI / CGCGGATCCCGCCACATCACCGACGGAC
Ncgl2578upR / GGATCGGCATCAAGCGCAGC
Ncgl2578dwF / GCTGCGCTTGATGCCGATCCCTCCACCCACTGACCTCCG
Ncgl2578dwRHindIII / CCCAAGCTTTGCACTTCCCGGAGGCTACC
Ncgl2578FBamHI / CGCGGATCCATGACTGCAACATTTGCTG
Ncgl2578RKpnI/SalI / CCAGGTACCGTCGACTTAGCTGCGCTTGATGCCG
Ncgl2578rbsFBamHI / CGCGGATCCAAAGGAGGACAACCATGACTGCAACATTTGCTG
N157AF / TGATTAGTCCATGGGCTTTCCCACTGAACCT
N157AR / AGGTTCAGTGGGAAAGCCCATGGACTAATCA
K180AF / CAACGCCGTAGTGATTGCGCCTGCGAGTGATACCCCAGTTAC
K180AR / GTAACTGGGGTATCACTCGCAGGCGCAATCACTACGGCGTTG
E199AF / GCACGAATCTTTGAGGCGGCCGGAGTTCCTGC
E199AR / GCAGGAACTCCGGCCGCCTCAAAGATTCGTGC
E258AF / CAATGAAAACTGTTGCACTAGCGCTCGGTGGCAACGCGCCG
E258AR / CGGCGCGTTGCCACCGAGCGCTAGTGCAACAGTTTTCATTG
C292AF / ACCAGGGACAGATTGCTATGTCAATCAACCG
C292AR / CGGTTGATTGACATAGCAATCTGTCCCTGGT

Underlined sites indicate restriction enzyme sites added for cloning. Mutated bases in the primers are shown in boldface and the ribosome binding site (rbs) is given in italic.

References:

1.  Schäfer, A. et al. Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 145,69-73 (1994).