Supplementary Information
Table S1 - Sequences of ChIP quantitative real time PCR primers
Gene / Sense primer / Antisense primer /Bdnf PI / 5'-tgatcatcactcacgaccacg-3' / 5'-cagcctctctctgagccagttacg-3' /
Bdnf PII / 5'-tgaggatagtggtggagttg-3' / 5'-taaccttttcctcctcc-3' /
Bdnf PIV / 5'-gcgcggaattctgattctggtaat-3’ / 5'-gagagggctccacgctgccttgacg-3' /
NR2a / 5'-tcggcttggactgatacgtg-3' / 5'-aggatagactgcccctgcac-3' /
NR2b / 5'-ccttaggaaggggacgcttt-3' / 5'-ggcaattaagggttgggttc-3' /
Egr-1 / 5'-gtgcccaccactcttggat-3' / 5'-cgaatcggcctctatttcaa-3' /
Egr-2 / 5'-ggctgcaaatcgttcctg-3' / 5'-tcggagtatttatgggcaggt-3'; /
Egr-3 / 5’-agctgccggt gaccatgagc-3’ / 5’-tccatcccgg gtgggaggct-3’ /
neurexin I / 5'-cagggcctttgtcctgaata-3' / 5'-gctttgaatggggttttgag-3' /
neurexin III / 5'-actgagagctagccacccagac-3' / 5'-ttgcccatttgtgaatttga-3'; /
agrin / 5'-ttgtaaccaacaggggttgc-3' / 5'-agttgtggctaggggagcac-3' /
cdk5 / 5'-cgcagcctgttggactttgt-3 / 3'-gcgttgcagaggaggtggta-3' /
Atf / 5'-gtgataacctggcagcttcg-3' / 5'-ggggtaactgtggcgttaga-3' /
PKM / 5'-tgttgagtctgggccctc-3' / 5'-cctggcctccggacc-3'; /
Creb / 5'-ctacaccagcttccccggt-3' / 5'-acggaaacagccgagctc-3' /
Mef2a / 5’- cagtagcggagactcggaat-3’ / 5’-cttctttcgccccattttca-3’ /
Hdac5 / 5’-gcattagagg cactgcggcc -3’ / 5’-gagttcatgc cggctctggg-3’ /
Rgs2 / 5’-aaacagctgc ggtggccgcg-3’ / 5’-cgcttctcct cgaccttggg-3’ /
Munc13 / 5’-aggagcggcc ggacccgcga-3’ / 5’- cagcgacatg gccgaggcgc-3’ /
c-fos / 5’-ctgagaagac tggatagagc -3’ / 5’- gagaacatca tggtcgaagt-3’ /
Nur77 / 5’- gcgaaagttg ggggagtgtg-3’ / 5’-aatacagggc atctccagcc-3’ /
Gapdh / 5'-ctcccaggaagaccctgctt-3' / 5'-ggaacagggaggagcagaga-3’ /
Cdc25a-peak / 5’-gcccataaccatgtcttgt-3’ / 5’-ggccacaccttctctaaaatc3’ /
Cdc25a-upstream / 5’-cgagacagggtttctctg-3’ / 5’- gtcacct tcagct gcacagg-3’ /
Cdc25a-downstream / 5’-cagagtctggagcagg-3’ / 5’-gccatc tggacc aggcgt-3’ /
Creb-peak / 5’-taggttctatcagtgagcc-3’ / 5’-caaagaaccacaagcaaagc-3’ /
Creb-upstream / 5’-ttatggatctggatgtagaa-3’ / 5’-agggacacc atgactgtag-3’ /
Creb-downstream / 5’-tcaagccatagaagtgatg-3’ / 5’-aggcttcaag cagaaagtgt-3’ /
Mef2d-peak / 5’-ctcctcagtggggctgca-3’ / 5’-tttccccagg tggggaagc-3’ /
Mef2d-upstream / 5’-gataggaggaggcagtttc-3’ / 5’-ccttcctcaa gccccttc-3’ /
Mef2d-downstream / 5’-gaaggggcttgaggttgg-3’ / 5’-cagccttga aggatggg-3’ /
P21-peak / 5’-caacaccagtagggtaaagg-3’ / 5’-aactgccca aatcccctt-3’ /
P21-upstream / 5’-tgtcagttctgatttctcag-3’ / 5’-aagagggact gtcagattt-3’ /
P21-downstream / 5’-caggcatgtacctctatgct-3’ / 5’-cttccttgc ttagagtta-3’ /
Table S2- Target Sequences of lentiviral shRNAs
Gene name (mouse) / shRNA target sequencehdac4-1 / ccggcctcagcaagataatctccaactcgagttggagattatcttgctgaggtttttg
hdac4-2 / ccggcatgggtttctgctactttaactcgagttaaagtagcagaaacccatgtttttg
hdac4-3 / ccgggttctacatcagagacccaatctcgagattgggtctctgatgtagaactttttg
hdac4-4 / ccggactctctgattgaggcgcaaactcgagtttgcgcctcaatcagagagttttttg
hdac9-1 / ccggccaagtaatcaataggctctactcgagtagagcctattgattacttggttttttg
hdac9-2 / ccgggctccaggatttgtaattaaactcgagtttaattacaaatcctggagcttttttg
pr65-1 / ccgggcaccgaatgactacactcttctcgagaagagtgtagtcattcggtgcttttt
pr65-2 / ccggccctaactacttacacagaatctcgagattctgtgtaagtagttagggtttttg
pp2ca-1 / ccggcgacgagtgtttaaggaaatactcgagtatttccttaaacactcgtcgtttttg
pp2ca-2 / ccgggcgacattgttggtcaagaatctcgagattcttgaccaacaatgtcgctttttg
gapdh / ccggtccgggaaactgtggcgtgatctcgagatcacgccacagtttcccggattttt
Table S3- Sequences of EMSA probes
Probe name / sequenceCre-up / -\5BiosG \agagattgcctgacgtcagagagctag
Cre-down / -\5BiosG \ctagctctctgacgtcaggcaatctct
Cre-mutant-up / -\5BiosG \agagattgcctgagacgggagagctag
Cre-mutant-down / -\5BiosG \ctagctctcccgtctcaggcaatctct
MEF2-up / -\5BiosG\cgctctaaaaataaccct
MEF2-down / -\5BiosG\agggttatttttagagcg
MEF2-mutant-up / -\5BiosG\cgctctaaggctaaccct
MEF2-mutant-down / -\5BiosG\agggttagccttagagcg
Supplemental Figures
Figure S1
HDAC4 but not HDAC5 or HDAC9 accumulates in Purkinje cell nuclei in human A-T or Atm/ mouse brain as well as Atm-deficient neurons.
a) Ten micron paraffin sections of human cerebellar cortex from individuals who died with no known brain disease or were diagnosed with A-T were immunostained with HDAC5 (Ab50001) or HDAC9 (Ab18970) antibody. Scale bar, 50 mm.
b) Ten micron cryostat sections of Atm+/+ and Atm-/- mouse cerebellum were immunostained with HDAC5 (green) and HDAC9 (red). Nuclei were counterstained with DAPI (blue). Scale bar, 50 mm.
c) Nuclear accumulation of HDAC4 is also found in other regions of the ATM-deficient brain. Ten micron cryostat sections of Atm+/+ and Atm-/- mouse brain were immunostained with HDAC4 (green). Nuclei were counterstained with DAPI (blue). Scale bar, 50 mm.
d) ATM shRNA results in nuclear accumulation of HDAC4 in cultured wild type neurons. E16.5 wild type mouse cortical neurons were transfected with either scrambled siRNA or Atm shRNA on DIV3. After 5 more days, cells were fixed and immunostained for HDAC4 or HDAC9. Scale bar, 20 mm.
Figure S2
Nuclear accumulation of HDAC4 leads to reduction of MEF2A-DNA and CREB-DNA interaction in ATM-deficient neurons
a) The physical association of MEF2A and CREB with HDAC4 is enhanced with HDAC4 nuclear translocation. Protein extracts from N2a cells overexpressing GFP-HDAC4 wild type (WT), L1602A or 3SA were immunoprecipitated and blotted with MEF2A, CREB and GFP antibodies.
b) Competition assay using excess cold (unlabeled) probe demonstrates the specificity of the DNA binding. Nuclear protein extracts from wild-type neurons (NE(WT)) were analyzed by EMSA using different wild type and mutant biotin probes or in the presence of excess (10X) unlabeled probes as indicated.
c) Western blots of cell lysates of neurons reveal the efficiency of Hdac4 and Hdac9 shRNA infection. Hdac1 served as an internal control.
Figure S3
Analysis of HDAC4 ChIP-sequencing data from Atm+/+ and Atm/ mouse cerebella
a) Semi-quantitative RT-PCRs from product of HDAC4 ChIP show the specificity of DNA binding for HDAC4 in Atm-/- cerebellum.
b) ChIP-qPCR analysis of HDAC4 occupancy at neuronal genes in wild type and Atm-/- cerebella. Each bar represents the average of three independent experiments; error bars denote SEM.
c) Genome-wide distribution of the HDAC4 ChIPseq peak density.The density of peaks (number of peaks identified by FindPeaks software per 1% of genome) is plotted by chromosomal location to show overall distribution of peaks by condition (Atm+/+ and Atm-/-)
d-g) ChIPseq-predicted HDAC4 peaks adjacent to (d) Cdc25a, (e) Cdkn1a (p21), (f) Creb1, and (g) Mef2d. qPCR results are plotted for wild type (Atm+/+, blue) and mutant (Atm/, red) over the positions of the PCR amplicons. Gene transcription patterns and directions are indicated below using standard genome browser images.
Figure S4
Inhibition of other HDACs has little effect on A-T phenotype
a) Na-butyrate injection (i.p.) cannot prevent neuronal cell death in the Atm-/- cerebellum. Fluorescent images of Atm-/- brain sections were immunostained for PCNA and cleaved caspase-3. Scale bar, 25 mm.
b) Quantification of degenerative markers for the experiment illustrated in panel A. Each bar represents the average of three independent experiments; error bars denote SEM.
Figure S5
Association of HDAC4 with 1433 was disrupted in Atm/ brain
a, b) Protein extracts from Atm+/+ and mutant (Atm/) cortex (ctx) and cerebellum (cblm) were immunoprecipitated with antibodies against 1433 (a) or HDAC4 (b). The immunoprecipitates were run on gels and blotted with anti-HDAC4 or anti-1433. Western blots of the lysates (WB) indicate the levels of protein in the starting material.
c) Loss of ATM increases the physical association of PP2A (both A and C subunits) with HDAC4. Brain lysates as in (a) and (b) were immunoprecipitated with HDAC4 antibody, and the immunoprecipitates run on gels then blotted with the antibodies indicated at the left.
Figure S6
PP2A but not HDAC4 is an ATM target and cell cycle reentry is determined by the location of HDAC4 in Atm-/- neurons
a) Protein extracts from N2a cells (100 µg) transfected with Flag-HDAC4, with or without exposure to etoposide (Eto), were immunoprecipitated with the anti-HDAC4 antibody. Immunoprecipitates were blotted with ATM/ATR substrate phosphorylation-specific antibody (P-[S/T]Q) and HDAC4.
b, c) Distribution of HDAC4 is controlled by ATM-mediated PP2A activity. Sequential images of representative GFP-HDAC4 that were transfected in wild type E16.5 cortical neurons then exposed to the ATM-specific inhibitor, KU55933 (10 mM) (b) or non-specific inhibitor, caffeine (2 mM), or after pretreatment with the PP2A inhibitor, endothall (c). The large panel shows the distribution of the GFP-fusion protein at time zero. The numeral in each of the small panels represents the time elapsed in hours after the addition of ATM inhibitor.
d) Knockdown of PP2A effectively blocks Ku55933-induced GFP-HDAC4 nuclear translocation.
e-f) GFP-tagged wild type HDAC4 or one of the three mutants described in the text were overexpressed in wild type and Atm-/- mouse primary neurons. cyclin A (e) and cyclin D1 (f) were used as cell cycle markers. The location of endogenous HDAC4 in untreated wild type and mutant neurons and the resulting effect on cell cycle markers was included as control (left panels).
Figure S7
The efficiency of lentiviral HDAC4 and its effect on histone acetylation in neurons and mice cerebella
a) Western blots of N2a cell lysates showed specific Hdac4 shRNAs exclusively against mouse endogenous HDAC4. Protein extracts were from N2a cells (rodent) transfected with GFP-HDAC4 (human) and blotted with non-specific HDAC4 antibody.
b) Western blots of primary neurons lysates from wild type and Atm/ reveals the effect of Hdac4 shRNAs on global histone acetylation.
c) Images of human HDAC4-stained mice cerebella showed the efficiency of gene transfer. shHdac4 (mouse) together with different human HDAC4 mutants lentivirus were injected into the cerebella of 8-week old mice. Scale bar, 100 mm.
d) Representative images of HDAC4 showed the efficiency of shHdac4-3 and -4. Scale bar, 50 mm.
e) Representative images of Ac-H3 showed the effects of different HDAC4 mutants on histone acetylation. Scale bar, 50mm.
Figure S8
ATM-dependent phosphorylation of PR65 is critical for neuroprotective function of cytoplasmic HDAC4 and a diagrammatic representation of the pathways discussed
a-b) Representative images of (a) PCNA- and (b) cleaved caspase-3-stained Purkinje cells show the effect of PR65 mutants on HDAC4-mediated function in mice cerebella. Mice were analyzed 1 week after injection, immunostaining for PR65 (green) and PCNA or cleaved caspase3 (red) were performed. Scale bar, 50 mm.
c) The phosphorylation of HDAC4 is an equilibrium between CaMKII or IV phosphorylation and PP2A dephosphorylation. The phosphorylated form binds to 1433 enabling it to remain cytoplasmic.
d) Normally ATM phosphorylates the PP2A-A subunit, which inhibits its binding to HDAC4 resulting in a reduced rate of dephosphorylation.
e) Inactivation of PP2A activity by ATM favors the CaMK side of the equilibrium. HDAC4 remains predominantly phosphorylated and, hence, bound to 1433. In ATM deficient cells, PP2A remains active, the equilibrium is then shifted in favor of the dephosphorylation reaction, 1433 binding is reduced and HDAC4 moves to the nucleus where it suppresses MEF2 and CREB activity, promotes a large-scale histone de-acetylation and leads to the suppression of neuronal survival genes and the up-regulation of cell cycle-related genes.
Supplementary Methods
Human subjects
Human autopsy tissue from four individuals diagnosed with A-T and four age-matched controls was obtained from UCLA Medical Center and Children’s Hospital Los Angeles. Brain tissue was routinely fixed, paraffin embedded, and sectioned at 10 µm. All A-T cases were confirmed both clinically and by post-mortem examination. The average age of the subjects was 21 years for the A-T patients and 25 years for non-A-T controls. The non-A-T controls were free of any known CNS neurological diseases at the time of death. Human frozen tissue was secured from 4 additional individuals diagnosed with A-T and four age-matched controls; the average age of the subjects was 18 years for the A-T patients and 20 years for non-A-T controls. Samples were obtained from the NICHD Brain and Tissue Bank of Developmental Disorders at the University of Maryland, Baltimore, MD (NICHD Brain and Tissue Bank for Developmental Disorders and NICHD (Contract #N01-HD-4-3368 and N01-HD-4-3383).
Animals
AtmtmBal/+ mice were a gift from Dr. Yang Xu. Timed pregnancies were established from these matings; the date of appearance of a vaginal plug was considered embryonic day 0.5 (E0.5). Embryos were taken at E16.5 for either cortical cultures or histology. All animal procedures were carried out in accordance with Rutgers University IACUC standards. The animal facilities at Rutgers University are fully AAALAC accredited.
Antibodies and chemical regents
Antibodies against HDAC4, HDAC5, HDAC9 and S632-HDAC4, PR65, pp2Ca, CREB, MEF2A and BrdU were obtained from Abcam. Antibodies against S246 HDAC4, acetylated H3 and H4, total histone 3 and 4 as well as antibodies against PP2A subunits were obtained from Cell Signaling. Human specific HDAC4 antibody (Y416) was from Novus Biologicals. Antibodies against HSP90 and HDAC1 were obtained from Biovision. Antibodies against P53-ser15, g-H2AX, BDNF, PSD95, Neurexin I, NR2A and NR2B cleaved caspase3 were from Abcam. Antibodies against PCNA, cyclin A and cyclin D1 and b-actin were from Santa Cruz. Secondary antibodies used for immunocytochemistry were as follows: chicken anti-mouse or rabbit Alexa 488; donkey anti-mouse or rabbit Alexa 594 (Invitrogen, Eugene, OR); all were used at a dilution of 1:500. DAPI (4',6'-diamidino-2-phenylindol) was used as a nuclear counter stain at 1 µg/ml. Endothall was from Calbiochem.
Constructs and plasmids
The Flag-ATM wild type and kinase dead (KD) plasmids were kindly provided by Dr. Michael B. Kastan (St. Jude’s Hospital for Children, Memphis, TN); GFP-HDAC4 and 3SA were provided by Dr. Tso-pang Yao (Duke University Medical Center, Durham, NC); Flag-HDAC4 was provided by Dr. Stuart Schreiber (Harvard University, Cambridge, MA). GST-PR65 GFP-PP2A-A, m-Cherry-PP2A-C, mCherry-CaMKII and IV were cloned from mouse brain mRNA by SuperScript III one-step RT-PCR system (Invitrogen). Site-direct mutation of GFP-PP2A-A on S401A and S401D and GST-PR65 on S401A and GFP-HDAC4 on 4A (R269A/R280A/K280A/R281A) and L1062A were performed by QuikChange Mutagenesis Kit (Stratagene, La Jolla, CA).
Primary neuronal cultures
Embryonic cortical neurons were isolated by standard procedures. For ATM-deficient cultures, all embryos from an AtmtmBal/+ x Atmtm1Bal/+ mating were harvested and treated separately then retrospectively genoytyped by PCR. Isolated E16.5 embryonic cerebral cortices were treated with 0.25% Trypsin-EDTA and dissociated into single cells by gentle trituration. Cells were suspended in Neurobasal medium supplemented with B27 and 2 mM glutamine, then plated on coverslips or dishes coated with poly-L-Lysine (5 mg/mL). All cultures were grown for a minimum of 5 days in vitro (DIV) before any treatment. All experiments were performed on a minimum of three cultures from three separate embryos; each condition was examined in triplicate. All transfections were carried out using Lipofectamine 2000 after 4-5 DIV. Live imaging of GFP was performed on a heated stage in a controlled 5% CO2 atmosphere at 7-10 DIV.
Immunohistochemistry
For DAB/brightfield staining, all paraffin-embedded human sections were deparaffinized in xylene and then rehydrated through graded ethanol to water. The sections were pretreated in 0.3% hydrogen peroxide in methanol for 30 min to remove endogenous peroxidase activity, rinsed in Tris-buffered saline (TBS), and then treated with 0.1 M citrate buffer in a microwave at sufficient power to keep the solution at 100°C for 20 min. Sections were cooled in the same buffer at room temperature (RT) for 30 min and rinsed in TBS. Slides were incubated in 10% goat serum in PBS blocking solution for 1 h at RT, after which primary antibody was applied to the sections that were then incubated at 4°C overnight. The sections were washed three times in TBS before applying the secondary antibody (Vector Laboratories). Secondary antibody was applied for 1 h at RT. Afterwards, sections were rinsed three times in TBS. Rinsed sections were then incubated in Vectastain ABC Elite reagent for 1 h and developed using diaminobenzidine, according to the protocol of the manufacturer (Vector Laboratories). The sections were counterstained with hematoxylin, and after dehydration all sections were mounted in Permount under a glass coverslip. Control sections were subjected to the identical staining procedure, except for the omission of the primary antibody.