Supplementary Tables and Figure
Table S1. 2-way analysis of variance (ANOVA) showing the effects of S. vermifera and COMT gene on biomass of low lignin (COMT down-regulated) switchgrass and wild type control colonized either in vitro or using bentonite clay as carrier 90 days after infection.Significant effects are marked as follows: 0.01p ≤ 0.05:*; 0.001 p ≤ 0.01:**; p ≤ 0.001: ***; and p > 0.05: ns.
Colonization Methods / Plant type / Colonization / Tiller (no.) / Tiller ht. (cm) / Shoot DW (g) / Root DW (g)In vitro / COMT / S vermifera / 15.60 b / 207.77 a / 58.58 a / 20.82 a
Control / 13.20 c / 184.51 b / 49.19 bc / 13.96 b
Wild Type / S vermifera / 19.80 a / 219.96 a / 54.93 ab / 19.35 a
Control / 16.00 b / 199.13 ab / 41.27 c / 13.84 b
LSD (0.05) / 2.19 / 20.22 / 8.77 / 3.42
Compare Means / COMT / 14.40 b / 196.14 a / 53.89 a / 17.39 a
Wild Type / 17.90 a / 209.55 a / 48.10 a / 16.60 a
S vermifera / 17.70 a / 213.86 a / 56.75 a / 20.09 a
Control / 14.60 b / 191.82 b / 45.23 b / 13.90 b
Main effects
COMT / *** / ns / ns / ns
S vermifera / *** / ** / ** / ***
Interactions
COMT X S vermifera / ns / ns / ns / ns
Bentonite Clay / COMT / S vermifera / 16.000 ab / 218.44 a / 57.22 a / 19.310 a
Control / 13.571 bc / 210.09 a / 46.88 b / 13.381 b
Wild Type / S vermifera / 18.286 a / 213.36 a / 57.77 a / 21.091 a
Control / 12.286 c / 184.67b / 51.40 b / 12.202 b
LSD (0.05) / 2.47 / 17.70 / 5.68 / 3.10
Compare Means / COMT / 14.78 a / 214.26 a / 52.05 a / 16.34 a
Wild Type / 15.28 a / 199.01 b / 54.59 a / 16.64 a
S vermifera / 17.14 a / 215.90 a / 57.49 a / 20.20 a
Control / 12.92 b / 197.38 b / 49.14 b / 12.79 b
Main effects
COMT / ns / * / ns / ns
S vermifera / *** / ** / *** / ***
Interactions
COMT X S vermifera / * / ns / ns / ns
Table S2. 2-way analysis of variance (ANOVA) showing the effect of S. vermifera and COMT gene on cell wall composition of low lignin (COMT down regulated) switchgrass and wild type control colonized invitro or using bentonite clay as carrier 90 days after infection. Significant effects are marked as follows: 0.01< p ≤ 0.05:*; 0.001< p ≤ 0.01:**; p ≤ 0.001: ***; and p > 0.05: ns.
Colonization Methods / Plant type / Colonization / Lignin (%) / S/G ratio / Glucose (g/g) / Xylose (g/g)In vitro / COMT / S vermifera / 16.96 c / 0.55 b / 0.26 ab / 0.21 b
Control / 17.76 bc / 0.52 b / 0.28 a / 0.23 a
Wild Type / S vermifera / 18.73 ab / 0.60 a / 0.24 b / 0.20 b
Control / 19.20 a / 0.62 a / 0.27 ab / 0.21 b
LSD (0.05) / 0.98 / 0.98 / 0.03 / 0.01
Compare
Means / COMT / 17.36 b / 0.53 b / 0.26 a / 0.21 a
Wild Type / 18.96 a / 0.61 a / 0.24 a / 0.20 b
S vermifera / 17.84 a / 0.57 a / 0.24 a / 0.20 b
Control / 18.48 a / 0.57 a / 0.26 a / 0.21 a
Main effects
COMT / *** / *** / ns / **
S vermifera / ns / ns / ns / **
Interaction
COMT X S vermifera / ns / ns / ns / ns
Bentonite Clay / COMT / S vermifera / 17.72 bc / 0.52 c / 0.26 ab / 0.21 b
Control / 16.81 c / 0.51 c / 0.28 a / 0.23 a
Wild Type / S vermifera / 19.36 a / 0.62 a / 0.24 b / 0.20 b
Control / 18.75 ab / 0.59 b / 0.27 ab / 0.21 b
LSD (0.05) / 1.04 / 0.03 / 0.03 / 0.01
Compare
Means / COMT / 17.26 b / 0.51 b / 0.26 a / 0.20 a
Wild Type / 19.05 a / 0.61 a / 0.23 b / 0.19 a
S vermifera / 18.54 a / 0.57 a / 0.24 b / 0.19 a
Control / 17.78 b / 0.55 a / 0.26 a / 0.20 a
Main effects
COMT / *** / *** / * / ns
S vermifera / * / ns / * / ns
Interaction
COMT X S vermifera / ns / ns / ns / *
Table S3.Results of the3-way ANOVA[1] showing the effects of S. vermifera (MAFF305830), COMT gene and method of colonization on biomass and cell wall composition of low lignin (COMT down-regulated) switchgrass and wild type control colonized invitro or using bentonite clay as carrier 90 days after infection. Significant effects are marked as follows: 0.01p ≤ 0.05:*; 0.001 p ≤ 0.01:**; p ≤ 0.001: ***; and p > 0.05: ns.
Method / Plant Type / Colonization / Tiller (no) / Tiller ht. (cm) / Shoot DW (g) / Root DW (g) / Lignin / S/G ratio / Glucose (g/g) / Xylose (g/g)Bentonite Clay / COMT / S vermifera / 16.00±1.06 bc / 218.44±7.18 a / 57.22±1.28 a / 19.31±0.61 a / 17.72±0.37 cd / 0.52±0.01 b / 0.249±0.02 a / 0.196±0.01 bc
Control / 13.57±0.42 cd / 210.09±4.88 ab / 46.88±1.46 bc / 13.38±0.37 b / 16.81±0.22 d / 0.51±0.00 b / 0.278±0.01 a / 0.215±0.01 ab
Wild Type / S vermifera / 18.28±0.96 ab / 213.36±6.25 a / 57.77±2.83 a / 21.09±1.02 a / 19.36±0.32 a / 0.62±0.00 a / 0.232±0.01 a / 0.200±0.01 bc
Control / 12.28±0.77 d / 184.67±5.71b / 51.40±1.81 ab / 12.20±1.72 b / 18.75±0.46 abc / 0.59±0.01 a / 0.243±0.01 a / 0.192±0.01 c
In vitro Colonization / COMT / S vermifera / 15.60±0.97 bc / 207.77±7.00 ab / 58.58±2.10 a / 20.82±0.77 a / 16.96±0.35 d / 0.55±0.02 b / 0.259±0.02 a / 0.206±0.01 bc
Control / 13.20±0.80 cd / 184.51±7.41 b / 49.19±1.61 abc / 13.96±1.22 b / 17.76±0.37 bcd / 0.52±0.00 b / 0.279±0.02 a / 0.227±0.01 a
Wild Type / S vermifera / 19.80±0.58 a / 219.96±7.28 a / 54.93±4.44 ab / 19.35±1.30 a / 18.73±0.26 abc / 0.60±0.01 a / 0.237±0.02 a / 0.196±0.01 bc
Control / 16.00±0.44 bc / 199.13±4.99 ab / 41.27±2.73 c / 13.84±1.19 b / 19.20±0.29 ab / 0.62±0.00 a / 0.260±0.02 a / 0.207±0.01 bc
LSD (0.05) / 2.58 / 20.03 / 7.35 / 3.46 / 1.10 / 0.03 / 0.03 / 0.01
Main effects
Method of Colonization / ns / ns / ns / ns / ns / ns / ns / *
COMT gene / ** / ns / ns / ns / *** / *** / ** / **
S vermifera / *** / *** / *** / *** / ns / ns / ** / **
Interaction
Method X COMT / * / ** / * / ns / ns / ns / ns / ns
Method X S vermifera / ns / ns / ns / ns / ** / ns / ns / ns
COMT X S vermifera / * / ns / ns / ns / ns / ns / ns / *
Method X COMT X S vermifera / ns / ns / ns / ns / ns / * / ns / ns
Table S4 2-way analysis of variance (ANOVA) showing the effects of colonization method and COMT gene on S. vermiferaroot colonization (percent biomass) 90 days after infection.Significant effects are marked as follows: 0.01p ≤ 0.05:*; 0.001 p ≤ 0.01:**; p ≤ 0.001: ***; and p > 0.05: ns.
Plant type / Colonization method / Fungal biomass in planta (%)COMT / Bentonite clay / 15.94ab
In vitro / 10.09 b
Wild Type / Bentonite clay / 20.11a
In vitro / 12.54 b
LSD (0.05) / 6.98
Compare Means / COMT / 13.11 a
Wild Type / 16.77 a
Bentonite clay / 17.92 a
In vitro / 11.45 b
Main effects
COMT / ns
Colonization method / **
Interactions
COMT X Method / ns
Table S5 List of primers used for the present study
Marker name / Primer sequence 5'3' / ReferenceNSSeb1 / CTTCTTAGAGGGACTGTCAGGA / Weiß et al. (2011)
NLSeb1.5R / ATTCGCTTTACCGCACAAGGC / Garnica et al. (2013)
ITS3Seb / GCATCGATGAAGAACGCAGC / Mary Berbee lab
ITS3Seb-R / GAGACCAAACTCCGGTGAAA / This study
NL4 / GGTCCGTGTTTCAAGACGG / O’Donnell (1993)
PvTef-F1 / ATGAACCACCCTGGGCA / This study
PvTef-R1 / TCACGGACAGCAAAGCGA / This study
Figure S1. Methodology of inoculation using bentonite clay (a) a uniform hole of 5 cm depth was prepared (b) transplantation of switchgrass tiller (c) (d) application of inoculum (e) invitro colonization; left: control, right colonized with S.vermifera.
Figure S2.Confirmation of colonization by nested PCR using Sebacina specific primers.(a) COMT and wild type plants colonized with S.vermifera either using clay or in vitro(b) un-inoculated control plants (c) gDNA from S.vermifera pure culture and from the in vitro colonized switchgrass roots with S.vermifera respectively were used as positive control. Root gDNA from switchgrass seedlings was used as negative
control.
1
[1]The 3-way ANOVA was conducted to determine if there was an effect of two different of methods of colonization. The effect of colonization method was non-significant (p 0.05); therefore, the data were analyzed using a 2-factor, factorial design (i.e., 2-way ANOVA) with two main factors: COMT (down-regulated and wild type; factor 1) and S. vermifera colonization (present or absent; factor 2) within each method of colonization, as well as the interaction between COMT and S. vermifera colonization. All results of the 2-way ANOVA are reported within the main text.
