Supplementary table 1Description of novel loci associated with Paget's disease of bone(PDB) according topublished genome-wide association studies(Albagha et al. 2010; Albagha et al. 2011)
Locus / Genes close toPDB-associated common variants / Function of the protein encoded by this gene
1p13 / CSF1
EPS8L3 / Osteoclastogenesis
Unknown function
7q33 / NUP205 / Transport between cytoplasm and nucleus
8q22 / TM7SF4 / Encodes DC-STAMP, osteoclastogenesis and osteoclast multinucleation
14q32 / RIN3 / Vesicular transport
15q24 / PML
GOLGA6A / TGF-β signaling pathway
Golgin, interaction with Golgi apparatus
Supplementary table 2 Main transcription factors involved in bone regulation
Name / Expressed in osteoblast / Expressed in osteoclast / ReferencesAj18 / X / (Marie 2008)
AKT / X / (Rosen 2008)
AP-1 / X / X / (Mellis et al. 2011; Rosen 2008)
ATF4 / X / (Rosen 2008)
BAP-x / X / (Marie 2008)
BMP2,7 / X / (Rosen 2008)
C/EBPβ / X / (Mellis et al. 2011)
CBF / X / (Javed et al. 2000)
CLOCK / X / (Karsenty et al. 2009)
CREB / X / (Sato et al. 2006)
Dlx3,5,6 / X / (Rosen 2008; Yang and Karsenty 2002)
E2F / X / (Rosen 2008)
EOS / X / (Mellis et al. 2011)
Hoxa2 / X / (Marie 2008)
Hoxa10 / X / (Marie 2008)
LEF-1 / X / (Jensen et al. 2010; Marie 2008)
MAFB / X / (Mellis et al. 2011)
MEF1 / X / (Marie 2008)
MITF / X / X / (Mellis et al. 2011; Rosen 2008; Yang and Karsenty 2002)
Msx 1 / X / (Rosen 2008)
Msx 2 / X / (Rosen 2008)
NF1 / (Karsenty 2008)
NFATc1 / X / X / (Rosen 2008)
NFKB / X / (Rosen 2008)
Nrf2 / X / (Marie 2008)
Osterix / X / (Rosen 2008)
P53 / X / (Marie 2008)
PPARγ / X / (Wan 2007)
PU-1 / X / (Mellis et al. 2011)
Rb / X / (Marie 2008)
Rsk2 / X / (Karsenty 2008)
Runx2 / X / (Rosen 2008)
Satb2 / X / (Karsenty 2008)
Shn3 / X / (Karsenty et al. 2009)
SMAD 1 / X / (Rosen 2008)
SMAD4 / X / (Rosen 2008)
SMAD5 / X / (Rosen 2008)
SMAD8 / X / (Rosen 2008)
Sox8 / X / (Marie 2008)
Sox9 / X / (Marie 2008)
Sp1 / X / (Jensen et al. 2010)
Sp3 / X / (Jensen et al. 2010)
Stat 1 / X / (Marie 2008)
TAZ / X / (Marie 2008)
TCF7 / X / (Jensen et al. 2010)
Twist / X / (Rosen 2008)
1
Supplementary table 3 Genotype phenotype associations in patients with Paget's disease of bone (PDB) for the SNPs located in 1p13 and 8q22 loci
Chr1; rs484959 G>A / Chr1; rs499345 C>AGenotypes / Uncor-
rected P / Genotypes / Uncor-
rected P
AA / AG or GG / RR / [95% CI ] / AA orAC / CC / RR / [95% CI ]
'Paget global sample' / Male sex, n (%) / 7 (33.3) / 14(60.3) / 0.02 / 0.34 / [0.13 - 0.88] / 113 (67.3) / 34 (40.0) / 3.3x10-5* / 3.05 / [1.78 - 5.24]
SQSTM1/P392L mutation, n (%) / 5 (23.8) / 23 (9.9) / 0.07 / 2.82 / [0.74 - 9.09] / 13 (7.7) / 15 (17.7) / 0.02 / 0.39 / [0.18 - 0.87]
Monostotic PDB, n (%) / 6 (28.6) / 103 (44.4) / 0.16 / 0.52 / [0.20 - 1.40] / 77 (45.8) / 32 (37.7) / 0.21 / 1.39 / [0.82 - 2.38]
Age at diagnosis (mean ± SD) / 59.0 ± 10.3 / 63.1 ± 10.6 / 0.08 / - / 63.1 ± 9.9 / 62.1 ± 11.9 / 0.47
Alkaline phosphatase† (time to mid point of normal range ± SD) / 5.2 ± 5.8 / 3.4 ± 5.3 / 0.15 / - / 3.5 ± 5.9 / 3.6 ± 4.2 / 0.94
Number of affected bones (mean ± SD) / 4.3 ± 4.0 / 2.7 ± 2.7 / 0.01 / - / 2.7 ± 2.6 / 3.1 ± 3.4 / 0.34
Renier's index (mean ± SD) / 12.8 ± 8.9 / 10.2 ± 9.0 / 0.22 / - / 10.4 ± 8.8 / 10.6 ± 10.0 / 0.90
'Subgroup
without SQSTM1' / Male sex, n (%) / 6 (37.5) / 126 (60.3) / 0.07 / 0.41 / [0.14 - 1.17] / 101 (65.2) / 31 (44.3) / 0.003* / 2.34 / [1.31 - 4.15]
Monostotic PDB, n (%) / 6 (37.5) / 98 (46.9) / 0.47 / 0.70 / [0.25 - 2.00] / 75(48.4) / 29(41.4) / 0.33 / 1.32 / [0.75 - 2.33]
Age at diagnosis (mean ± SD) / 58.4 ± 11.8 / 63.5 ± 10.8 / 0.07 / - / 63.3 ± 10.0 / 62.7 ± 12.7 / 0.69
Alkaline phosphatase† (time to mid point of normal range ± SD) / 4.1 ± 4.5 / 3.1 ± 3.1 / 0.21 / - / 3.2 ± 3.1 / 3.0 ± 3.4 / 0.74
Number of affected bones (mean ± SD) / 2.7 ± 1.9 / 2.4 ± 2.1 / 0.62 / - / 2.5 ± 2.1 / 2.4 ± 2.1 / 0.85
Renier's index (mean ± SD) / 10.8 ± 7.3 / 9.8 ± 8.3 / 0.65 / - / 10.1 ± 8.3 / 9.5 ± 8.1 / 0.62
RR=relative risk; SD= standard deviation. † Some patients were treated before serum alkaline phosphatase was measured.* These uncorrected P-values remained statistically significant after conservative Bonferroni’s correction (threshold of P-value after correction= 0.007).
1
Chr1; rs10494112 A>G / Chr 8; rs2458413 G>AGenotypes / Uncor-
rected P / Genotypes / Uncor-
rected P
AG orGG / AA / RR / [95% CI ] / AG / AA orGG / RR / [95% CI ]
'Paget global sample' / Male sex, n (%) / 86 (67.7) / 61 (48.4) / 0.002* / 2.22 / [1.33 - 3.70] / 85 (55.9) / 59 (64.1) / 0.21 / 0.71 / [0.42 - 1.22]
SQSTM1/P392L mutation, n (%) / 8 (6.3) / 20 (15.9) / 0.02 / 0.37 / [0.16 - 0.87] / 15 (9.9) / 10(10.9) / 0.80 / 0.89 / [0.38 - 2.06]
Monostotic PDB, n (%) / 49(38.9) / 60 (47.2) / 0.18 / 0.71 / [0.43 - 1.17] / 65 (42.8) / 39(42.4) / 0.95 / 1.01 / [0.60 - 1.71]
Age at diagnosis (mean ± SD) / 62.8 ± 10.0 / 62.8 ± 11.3 / 0.94 / - / 61.6 ± 11.1 / 64.8 ± 9.5 / 0.025
Alkaline phosphatase† (time to mid point of normal range ± SD) / 3.5 ± 6.5 / 3.6 ± 3.9 / 0.94 / - / 3.9 ± 6.5 / 3.0 ± 2.6 / 0.19
Number of affected bones (mean ± SD) / 2.8 ± 2.7 / 3.0 ± 3.0 / 0.55 / - / 2.9 ± 3.0 / 2.8 ± 2.5 / 0.78
Renier's index (mean ± SD) / 10.2 ± 9.1 / 10.7 ± 8.9 / 0.63 / - / 10.0 ± 9.1 / 10.8± 8.6 / 0.52
'Subgroup
without SQSTM1' / Male sex, n (%) / 79 (66.4) / 53 (50.0) / 0.01 / 1.96 / [1.15 - 3.36] / 77 (56.2) / 54(65.9) / 0.16 / 0.67 / [0.38 - 1.18]
Monostotic PDB, n (%) / 59 (49.6) / 45 (42.5) / 0.28 / 1.33 / [0.78 - 2.25] / 63(46.0) / 37(45.1) / 0.90 / 1.03 / [0.60 - 1.79]
Age at diagnosis (mean ± SD) / 63.1 ± 10.0 / 63.2 ± 11.9 / 0.97 / - / 62.0 ± 11.3 / 65.0 ± 9.8 / 0.05
Alkaline phosphatase† (time to mid point of normal range ± SD) / 3.1 ± 3.0 / 3.25 ± 3.45 / 0.67 / - / 3.2 ± 3.5 / 3.1 ± 2.8 / 0.70
Number of affected bones (mean ± SD) / 2.5 ± 2.2 / 2.4 ± 1.9 / 0.72 / - / 2.4± 1.9 / 2.5 ± 2.3 / 0.63
Renier's index (mean ± SD) / 10.0 ± 8.6 / 9.8 ± 7.8 / 0.88 / - / 9.4 ± 7.9 / 10.5 ± 8.6 / 0.36
RR=relative risk; SD=standard deviation.† Some patients were treated before serum alkaline phosphatase was measured. * These uncorrected P-values remained statistically significant after conservative Bonferroni’s correction (threshold of P-value after correction= 0.007).
1
Supplementary table 4Reasons for candidate gene selection within loci associated with Paget's disease of bone (PDB) in the French-Canadian population
Locus / Gene Symbol(Gene name) / Reasons for candidate gene selection / References
1p13 / ALX3
(Homeobox protein
aristaless-like 3) / Involved in apoptosis regulation
Craniofacial malformations and apoptosis abnormalities in embryos of mice Alx3-/-Alx4-/- / (Mirasierra et al. 2011)
(Beverdam et al. 2001)
1p13 / AMPD2
(Adenosine monophosphate deaminase 2) / Interaction with protein involved in ubiquitin-proteasome signaling, in Wnt signaling and in apoptosis regulation / GeneCards
1p13 / CSF1
(Colony stimulating factor 1) / Located close a SNP, rs484959, found to be associated with PDB
Involved in ossification, in osteoclast differentiation, in osteolysis and in odontogenesis / (Albagha et al. 2010)
(Caetano-Lopes et al. 2009)
(Wise et al. 2005)
(Gallet et al. 2006)
1p13 / EPS8L3
(Epidermal growth factor receptor kinase substrate 8-like protein 3) / Located close a SNP, rs484959, found to be associated with PDB / (Albagha et al. 2010)
Pathway Central
1p13 / GSTM3
(Glutathione S-transferase
mu 3 (brain) / A genotype of this gene is associated with decreased survival of individuals with osteosarcoma metastasis
Interaction with proteins involved in NF-ƘB signaling pathway, in apoptosis, in autophagy and in ubiquination
Participates into detoxification of oxydative stress products / (Salinas-Souza et al. 2010)
GeneCards
EntrezGene
1p13 / GSTM4
(Glutathione
S-transferase mu 4) / Involved in Ewing sarcoma pathogenesis
Participates into detoxification of oxydative stress products / (Luo et al. 2009)
EntrezGene
1p13 / PSMA5
(Proteasome subunit,
alpha type, 5) / Involved in proteasome assembly, in ubiquination regulation and in apoptosis / (McNaught et al. 2001)
7q33 / C7orf49
(Chromosome 7 open reading frame 49) / May act as a regulator of proteasome / (Agarwal et al. 2006)
UniProtKB /Swiss prot
7q33 / CNOT4
(CCR4-NOT transcription complex, subunit 40) / Has E3 ubiquitin ligase activity. The CCR4-NOT complex functions as general transcription regulation complex
Autoubiquitinated
Ubiquitin-protein ligase activity
Involved in protein modification; proteinubiquitination / (Winkler et al. 2004)
(Albert et al. 2002)
(van Wijk et al. 2009)
(Mersman et al. 2009)
7q33 / NUP205
(Nucleoporin 205kDa) / Involved in autophagy system
A SNP of this gene is associated with PDB / (Behrends et al. 2010)
(Albagha et al. 2011)
(Grandi et al. 1997)
8q22 / CTHRC1
(Collagen triple helix
repeat containing 1) / Involved in Wnt signaling
Decreased bone formation and decreased bone mass in mice CTHRC1 -/- / (Kimura et al. 2008)
GeneCards
8q22 / LRP12
(Low density lipoprotein receptor-related protein 12) / LRP family of genes involved in Wnt signaling / (Kubota et al. 2009)
8q22 / TM7SF4
(Transmembrane 7 superfamily member 4) / An intragenic SNP of this gene, rs2458413, is associated with PDB
Encodes DC-STAMP protein(Dendritic cells-specific transmembrane protein)
Involved in osteoclastogenesis mediated by TNFSF11A (RANKL) and in osteoclast multinucleation
Decreased bone resorption and increase bone mineral density in mice TM7SF4 -/-
Interaction with NFATc1, a transcription factor involved in osteoclastogenesis regulation / (Albagha et al. 2011)
(Chung et al. 2010)
(Yagi et al. 2005)
GeneCards
15q24 / CD276
(CD276molecule) / Involved in positive regulation of bone mineralization (Gene ontology)
Weakly expressed in resting monocytes.
Expressed in dendritic cells derived from monocytes / (Chapoval et al. 2001)
(Suh et al. 2004)
15q24 / PML
(Promyelocyticleukemia) / Key component of PML nuclear bodies that regulate a large number of cellular processes by facilitating post-translational modification of target proteins, promoting protein-protein contacts, or by sequestering proteins
Functions as tumor suppressor
Required for normal, caspase-dependent apoptosis in response to DNA damage, FAS, TNF, or interferons. Plays a role in transcription regulation
Regulates p53/TP53 levels by inhibiting its ubiquitination and proteasomal degradation
Plays a role in neoangiogenesis and tumor vascularization
Interacts (via C-terminus) with p53/TP53. Recruits p53/TP53 and CHEK2 into PML bodies, which promotes p53/TP53 phosphorylation at 'Ser-20' and prevents its proteasomal degradation
Ubiquitinated; mediated by RNF4, SIAH1 or SIAH2 and leading to subsequent proteasomal degradation. 'Lys-6'-, 'Lys-11'-, 'Lys-48'- and 'Lys-63'-linked polyubiquitination by RNF4 is polysumoylation-dependent
Acetylation may promote sumoylation and enhance induction of apoptosis
ubiquitinprotein ligase binding / (Zhong et al. 2000)
(Guo et al. 2000).
(Albagha et al. 2011)
15q24 / GOLGA6A
(Golgin A6 family, member A) / A SNP in between PML and GOLGA6A genes is associated PDB / (Huang et al. 2010)
(Albagha et al. 2011)
15q24 / CCDC33
(Coiled-coil domain containing 33) / Protein binding calcium dependent / (Trynka et al. 2009)
15q24 / UBL7
(Ubiquitin-like 7 (bone marrow stromal cell-derived)) / Binds ubiquitin
Bone marrow stromal cell ubiquitin-like protein / (Chang et al. 2006)
(Liu et al. 2003)
1
Supplementary table 5 Common variants already referenced in EntrezSNPand found in this project
ID / Location / Variant description / In silicoprediction of function / FrequenciesGene name / SNP ID / Genomic position* / Gene position* / Nucleotide / Aminoacid / Type of amino acid change / PolyPhen (P)
SIFT (S) / Reference MAF
(Entrez SNP)
AMPD2 / rs55646629 / 1:110162548 / 5' UTR / c.-343C>T / 0.19
AMPD2 / rs28362580 / 1:110162918 / Intron / c.10+18T>C / 0.16
AMPD2 / rs28362581 / 1:110163879 / Intron / c.10+979G>A / 0.21
AMPD2 / rs493972 / 1:110168888 / Intron / c.341+38C>G / 0.22
AMPD2 / rs865774 / 1:110169190 / Intron / c.450+141C>T / 0.10
AMPD2 / rs524998 / 1:110169957 / Intron / c.779+19A>G / 0.18
AMPD2 / rs863978 / 1:110170896 / Exon / c.1191T>C / p.His397His / Synonymous / 0.22
AMPD2 / rs560674 / 1:110171525 / Intron / c.1490+97C>G / 0.11
AMPD2 / rs523786 / 1:110171705 / Intron / c.1491-26A>C / 0.19
AMPD2 / rs2269340 / 1:110172236 / Intron / c.1781+124T>C / 0.27
AMPD2 / rs2269341 / 1:110172362 / Intron / c.1782-56C>T / 0.37
AMPD2 / rs568686 / 1:110173775 / 3' UTR / c.*1G>T / 0.11
C7orf49 / rs12532630 / 7:134855906 / Upstream / c.-144-479G>A / 0.48
C7orf49 / rs76510925 / 7:134855725 / Upstream / c.-144-298G>C / 0.46
C7orf49 / rs2288239 / 7:134855724 / Upstream / c.-144-297T>C / 0.46
C7orf49 / rs62481876 / 7:134855719 / Upstream / c.-144-292A>G / 0.40
C7orf49 / rs116133465 / 7:134855546 / Upstream / c.-144-118C>A / 0.08
C7orf49 / rs292507 / 7:134855492 / Upstream / c.-144-65G>A / 0.51
C7orf49 / rs11761021 / 7:134853888 / Intronic / c.-120-76C>T / 0.31
C7orf49 / rs9649052 / 7:134853844 / Intronic / c.-120-32G>T / 0.52
CCDC33 / rs351174 / 15:74528508 / Upstream / c.-431-122G>A / 0.68
CCDC33 / rs351175 / 15:74528985 / 5’UTR / c.-76T>G / 0.23
CCDC33 / rs56107695 / 15:74560776 / Exon / c.523G>T / p.Gly175Cys / Radical / P: Probably damaging
S: Deleterious / 0.13
CCDC33 / rs1484212 / 15:74588024 / Intron / c.1096-71T>C / 0.31
CCDC33 / rs173272 / 15:74588380 / Intron / c.1290+91C>T / 0.16
CCDC33 / rs2277602 / 15:74622457 / Intron / c.1291-73A>C / 0.28
CCDC33 / rs2277603 / 15:74622533 / Exon / c.1294A>G / p.Met432Val / Conservative / P: Benign
S: Tolerated / 0.08
CCDC33 / rs1564782 / 15:74622678 / Exon / c.1439G>A / p.Ser480Asn / Radical / P: Benign
S: Tolerated / 0.72
CCDC33 / rs2277605 / 15:74623272 / Intron / c.1546-50G>A / 0.68
CCDC33 / rs2277606 / 15:74623302 / Intron / c.1546-20T>C / 0.68
CCDC33 / rs900802 / 15:74628242 / Intron / c.2140-24C>T / 0.29
CD276 / rs7173448 / 15:73994806 / Exon / c.290C>T / p.Pro97Leu / Radical / P: Benign
S: Tolerated / 0.08
CD276 / rs7173476 / 15:73994847 / Exon / c.331C>A / p.Arg111Ser / Radical / P: Benign
S: Tolerated / 0.07
CD276 / rs11574478 / 15:73995165 / Intron / c.418+231A>C / 0.25
CD276 / rs11574479 / 15:73995173 / Intron / c.418+239C>T / 0.25
CD276 / rs11574480 / 15:73995431 / Intron / c.418+497G>T / 0.083
CD276 / rs11574483 / 15:73996066 / Intron / c.419-451G>A / 0.10
CD276 / rs10083681 / 15:73996101 / Intron / c.419-416G>A / 0.10
CD276 / rs2291014 / 15:73996359 / Intron / c.419-158G>A / 0.059
CD276 / rs2291012 / 15:74000729 / Exon / c.765G>C / p.Leu255Leu / Synonymous / 0.07
CD276 / rs2291011 / 15:74000839 / Intron / c.850+25G>A / 0.57
CD276 / rs3825859 / 15:74002006 / Exon / c.868G>A / p.Gly290Arg / Radical / P: Possibly damaging
S: Tolerated / 0.07
CD276 / rs966378 / 15:74003533 / Intron / c.928+22G>A / 0.10
CNOT4 / rs3763425 / 7:135195320 / Upstream / c.-280-495C>T / 0.11
CNOT4 / rs3828960 / 7:135194613 / Intron / c.-93+24T>C / 0.19
CNOT4 / rs73158933 / 7:135099901 / Intron / c.459+24C>T / 0.20
CNOT4 / rs77841106 / 7:135082953 / Exon / c.847C>G / p.Leu283Val / Conservative / P: Possibly damaging
S: Tolerated / 0.15
CNOT4 / rs3750067 / 7:135047964 / Intron / c.1628-26C>T / 0.12
CSF1 / rs2297706 / 1:110456866 / Intron / c.40-15C>A / 0.31
CSF1 / rs2275123 / 1:110458234 / Intron / c.163-22G>A / 0.21
CSF1 / rs3093044 / 1:110459730 / Intron / c.226-185G>A / 0.26
CSF1 / rs333967 / 1:110459773 / Intron / c.226-142C>T / 0.30
CSF1 / rs333970 / 1:110466338 / Exon / c.1095C>A / p.Thr365Thr / Synonymous / 0.44
CSF1 / rs2229166 / 1:110466810 / Exon / c.1567C>A / p.Arg523Arg / Synonymous / 0.32
CTHRC1 / rs3736052 / 8:104383755 / 5' UTR / c.-130G>C / 0.07
CTHRC1 / rs6468870 / 8:104388276 / Intron / c.372+89A>T / 0.24
CTHRC1 / rs2917549 / 8:104388418 / Intron / c.372+231A>G / 0.27
CTHRC1 / rs7845210 / 8:104388574 / Intron / c.372+387A>C / 0.24
CTHRC1 / rs2687364 / 8:104390224 / Intron / c.373-31T>A / 0.49
CTHRC1 / rs3098232 / 8:104394631 / Intron / c.590-55A>G / 0.10
CTHRC1 / rs3098233 / 8:104394744 / Exon / c.648T>C / p.Gly216Gly / Synonymous / 0.27
EPS8L3 / rs943641 / 1:110306531 / 5' UTR / c.-112T>C / 0.18
EPS8L3 / rs878605 / 1:110306469 / 5' UTR / c.-50G>C / 0.17
EPS8L3 / rs878604 / 1:110306416 / Intron / c.-25+28G>A / 0.17
EPS8L3 / rs878603 / 1:110306384 / Intron / c.-25+60C>A / 0.17
EPS8L3 / rs3738771 / 1:110306211 / Intron / c.-25+233A>G / 0.33
EPS8L3 / rs7534315 / 1:110305699 / Intron / c.-25+745C>G / 0.24
EPS8L3 / rs78633716 / 1:110305687 / Intron / c.-25+757A>G / 0.06
EPS8L3 / rs7534218 / 1:110305588 / Intron / c.-25+856C>G / 0.20
EPS8L3 / rs7534019 / 1:110305452 / Intron / c.-25+992C>T / 0.24
EPS8L3 / rs7542853 / 1:110305409 / Intron / c.-24-1014G>A / 0.17
EPS8L3 / rs7533771 / 1:110305188 / Intron / c.-24-793C>A / 0.18
EPS8L3 / rs17024790 / 1:110304777 / Intron / c.-24-382C>T / 0.06
EPS8L3 / rs6676659 / 1:110304537 / Intron / c.-24-142C>T / 0.30
EPS8L3 / rs6693815 / 1:110301260 / Exon / c.490G>A / p.Gly164Ser / Radical / P: Benign
S: Tolerated / 0.31
EPS8L3 / rs11102002 / 1:110300277 / Intron / c.898-100G>A / 0.11
EPS8L3 / rs11102001 / 1:110299691 / Exon / c.1069C>T / p.Pro357Ser / Conservative / P: Benign
S: Tolerated / 0.15
EPS8L3 / rs2094469 / 1:110299550 / Intron / c.1121+89T>C / 0.23
EPS8L3 / rs1887548 / 1:110295890 / Intron / c.1122-70G>C / 0.26
EPS8L3 / rs1887547 / 1:110295772 / Exon / c.1170A>G / p.Ser390Ser / Synonymous / 0.25
EPS8L3 / rs1887546 / 1:110295643 / Intron / c.1203+96C>A / 0.33
EPS8L3 / rs2274536 / 1:110294577 / Intron / c.1437+40T>C / 0.33
EPS8L3 / rs45612540 / 1:110293989 / Intron / c.1567-16T>C / 0.07
EPS8L3 / rs15864 / 1:110292856 / 3' UTR / c.*157C>G / 0.34
GSTM3 / rs4970777 / 1:110283785 / Intron / c.-225+513G>A / 0.26
GSTM3 / rs1332018 / 1:110282972 / 5' UTR / c.-63C>A / 0.27
GSTM3 / rs1537234 / 1:110279821 / Intron / c.580-30G>T / 0.47
GSTM3 / rs7483 / 1:110279701 / Exon / c.670G>A / p.Val224Ile / Conservative / P: Benign
S: Tolerated / 0.36
GSTM3 / rs2234696 / 1:110279602 / 3' UTR / c.*91A>C / 0.13
GSTM4 / rs668413 / 1:110195944 / Upstream / c.-309-2759C>A / 0.40
GSTM4 / rs569998 / 1:110196305 / Upstream / c.-309-2398A>T / 0.40
GSTM4 / rs656025 / 1:110196429 / Upstream / c.-309-2274G>A / 0.40
GSTM4 / rs2781815 / 1:110196507 / Upstream / c.-309-2196T>C / 0.13
GSTM4 / rs1010167 / 1:110198727 / 5' UTR / c.-303C>G / 0.43
GSTM4 / rs560018 / 1:110200360 / Intron / c.260-34T>C / 0.18
GSTM4 / rs506008 / 1:110201699 / Exon / c.534T>C / p.Phe178Phe / Synonymous / 0.20
GSTM4 / rs562996 / 1:110201809 / Intron / c.567+77G>T / 0.10
GSTM4 / rs563003 / 1:110201812 / Intron / c.567+80A>G / 0.10
GSTM4 / rs670439 / 1:110207482 / Downstream / c.+440+3160C>T / 0.10
GSTM4 / rs1051137 / 1:110208089 / Downstream / c.440+3767A>T / 0.28
LRP12 / rs16871500 / 8:105510326 / Intron / c.476-22A>C / 0.14
NUP205 / rs57312488 / 7:135242122 / Upstream / c.-26-545T>A / 0.23
NUP205 / rs73725137 / 7:135261689 / Intron / c.489-28G>A / 0.05
NUP205 / rs10252250 / 7:135262533 / Intron / c.649-11T>C / 0.44
NUP205 / rs73725145 / 7:135263735 / Intron / c.1042+72A>G / 0.05
NUP205 / rs11772654 / 7:135277626 / Intron / c.1625-109C>G / 0.16
NUP205 / rs76481679 / 7:135277647 / Intron / c.1625-88T>C / 0.16
NUP205 / rs7800214 / 7:135279315 / Exon / c.1851A>C / p.Ala617Ala / Synonymous / 0.48
NUP205 / rs79816318 / 7:135282698 / Intron / c.2065-48A>G / 0.12
NUP205 / rs73725182 / 7:135291001 / Intron / c.2905+27C>T / 0.14
NUP205 / rs61734151 / 7:135292098 / Exon / c.3174G>A / p.Gln1058Gln / Synonymous / 0.05
NUP205 / rs73725194 / 7:135298858 / Intron / c.3196-49G>A / 0.05
NUP205 / rs6972359 / 7:135310205 / Intron / c.4671+102A>G / 0.45
NUP205 / rs10085457 / 7:135310860 / Intron / c.4672-128G>A / 0.34
NUP205 / rs7810260 / 7:135311120 / Intron / c.4793+11G>A / 0.55
NUP205 / rs7799891 / 7:135322853 / Intron / c.5265+46T>C / 0.21
NUP205 / rs73725437 / 7:135327853 / Intron / c.5393-87G>A / 0.13
NUP205 / rs10260691 / 7:135328110 / Intron / c.5559+4C>T / 0.35
NUP205 / rs12540688 / 7:135329690 / Exon / c.5607T>C / p.Ala1869Ala / Synonymous / 0.21
NUP205 / rs12530845 / 7:135329978 / Intron / c.5683+212T>C / 0.21
NUP205 / rs62479523 / 7:135330829 / Intron / c.5813-77C>A / 0.18
PML / rs5742914 / 15:74286929 / Upstream / c.-96-129C>T / 0.05
PML / rs3825941 / 15:74317362 / Intron / c.1254+94G>A / 0.28
PML / rs2304718 / 15:74326711 / Intron / c.1658-108G>A / 0.61
PML / rs77769571 / 15:74326717 / Intron / c.1658-102C>T / 0.06
PML / rs743580 / 15:74328116 / Intron / c.1710+1245A>G / 0.54
PML / rs743581 / 15:74328141 / Intron / c.1710+1270G>T / 0.38
PML / rs5742915 / 15:74336633 / Exon / c.1933T>C / p.Phe645Leu / Radical / P: Benign
S: Tolerated / 0.50
PML / rs61751122 / 15:74336656 / Exon / c.1956C>T / p.Ala652Ala / Synonymous / 0.14
PSMA5 / rs3820667 / 1:109968410 / Intron / c.29+514T>G / 0.44
PSMA5 / rs17647543 / 1:109964605 / Intron / c.30-57A>G / 0.06
PSMA5 / rs1465607 / 1:109958035 / Intron / c.97-50A>G / 0.26
TM7SF4 / rs3808396 / 8:105350763 / Upstream / c.-50-1291G>A / 0.06
TM7SF4 / rs2458418 / 8:105350851 / Upstream / c.-50-1203A>G / 0.34
TM7SF4 / rs3824155 / 8:105351070 / Upstream / c.-50-984C>T / 0.12
TM7SF4 / rs2514666 / 8:105351943 / Upstream / c.-50-111C>T / 0.34
TM7SF4 / rs2458415 / 8:105351998 / Upstream / c.-50-56A>C / 0.33
TM7SF4 / rs3088027 / 8:105361095 / Exon / c.315C>T / p.Ile105Ile / Synonymous / 0.12
TM7SF4 / rs67114147 / 8:105361354 / Exon / c.574G>C / p.Glu192Gln / Radical / P: Benign
S: Tolerated / 0.12
TM7SF4 / rs2458431 / 8:105367096 / Intron / c.1030-9T>C / 0.42
TM7SF4 / rs3802204 / 8:105367121 / Exon / c.1046A>G / p.Asp349Gly / Radical / P: Benign
S: Tolerated / 0.10
TM7SF4 / rs4734780 / 8:105368408 / Exon / c.1395A>G / p.Ala465Ala / Synonymous / 0.06
TM7SF4 / rs3808401 / 8:105368685 / 3’ UTR / c.*259G>C / 0.10
TM7SF4 / rs75453075 / 8:105368929 / Downstream / c.+491+12T>A / 0.43
TM7SF4 / rs2669453 / 8:105368930 / Downstream / c.+491+13C>A / 0.48
TM7SF4 / rs2514665 / 8:105351531 / Upstream / c.-50-523C>T / 0.31
UBL7 / rs7166701 / 15:74749015 / Intron / c.185-3T>C / 0.11
UBL7 / rs2289188 / 15:74742468 / Intron / c.531-58T>C / 0.42
* Genomic and gene locations according to 1000 genomes database (first transcript). MAF= minor allele frequency.
1
Supplementary table 6Rare genetic variants already referenced in EntrezSNPor 1000 genomes database and detected in this project
Identification / Variant description / In silico predicted functional effect / FrequenciesGene name / Variant ID / Genomic position
* / Gene position
* / Nucleotide / Aminoacid / Type of amino acid change / Amino-acid
PolyPhen (P)
SIFT (S)
Condel (C ) / Transcription factors
Gain (G)
Loss (L) / Splicing sites
Branch point (B)
Splice site (S) / Minorallelefrequencies
Reference MAF
EntrezSNP
Cases / Controls
ALX3 / rs140818662 / 1:110611390 / Intron / c.277+1568G>C / B: New site
S: New site / N/A / 0.019 / 0
ALX3 / rs187310064 / 1:110611263 / Intron / c.277+1695G>A / S: New site / N/A / 0.019 / 0
ALX3 / rs144523285 / 1:110603286-110603259 / 3' UTR / c.*69_*96ins
CCTGCCTGGACACCACGGAGGAAGCACC / S: Broken site / N/A / 0.48 / 0.50
AMPD2 / rs58720505 / 1:110162073 / Upstream / c.-432-386G>A / S: Broken site
S: New site / 0.041 / 0.038 / 0
AMPD2 / rs41280332 / 1:110171120 / Intron / c.1326+3A>G / 0.011 / 0.020 / 0
AMPD2 / rs111379057 / 1:110171552 / Intron / c.1490+124A>G / G: NF-kappaB
G: c-REL / 0.013 / 0.017 / 0
AMPD2 / rs72705206 / 1:110172176 / Intron / c.1781+64C>T / S: New site / 0.019 / 0.016 / 0
AMPD2 / rs72502382 / 1:110172351-110172350 / Intron / c.1782-68delG / N/A / 0.26 / 0.13
AMPD2 / rs2777905 / 1:110172592 / Intron / c.1902+54C>A / 0.006 / 0.015 / 0
AMPD2 / rs56079255 / 1:110162190 / Upstream / c.-432-269C>T / 0.02 / 0.060 / 0
AMPD2 / rs114804066 / 1:110162995 / Intron / c.10+95A>G / S: Broken site / 0.007 / 0.034 / 0
AMPD2 / rs116681683 / 1:110169198 / Intron / c.450+149C>T / 0.019 / 0.036 / 0
AMPD2 / rs55739424 / 1:110170640 / Intron / c.1000-65G>T / L: C/EBPβ / B: New site / 0.025 / 0.040 / 0
AMPD2 / rs56246993 / 1:110170641 / Intron / c.1000-64C>T / L: C/EBPβ / 0.015 / 0.040 / 0
AMPD2 / rs34030799 / 1:110170728 / Exon / c.1023G>A / p.Ser341Ser / Synonymous / G: CREB / 0.014 / 0.040 / 0
CCDC33 / ESP_15_74564187 / 15:74564187 / Intron / c.638+52G>A / S: Broken / N/A / 0.037 / 0
CCDC33 / rs79172627 / 15:74565181 / Exon / c.708G>A / p. Pro236Pro / Synonymous / 0.017 / 0.042 / 0
CCDC33 / rs139841902 / 15:74588058 / Intron / c.1096-37G>A / 0.007 / 0.016 / 0
CCDC33 / rs145199070 / 15:74623497 / Intron / c.1677+44A>G / S: Broken site / 0.006 / 0.016 / 0
CCDC33 / rs137878325 / 15:74623630 / Exon / c.1764C>A / p. Pro588Pro / Synonymous / G: c-REL
G: NF-kappaB / 0.003 / 0.016 / 0
CD276 / rs77067414 / 15:73995481 / Intron / c.418+547G>A / 0.042 / 0.016 / 0
CD276 / rs201889944 / 15:73995991 / Intron / c.419-526C>T / L: Sp1 / N/A / 0.016 / 0
CD276 / rs143255170 / 15:73996590 / Exon / c.492G>A / p. Thr164Thr / Synonymous / 0.038 / 0.016 / 0.13
CD276 / rs62641691 / 15:73996729 / Exon / c.631G>A / p.Val211Met / Conservative / P: Probably damaging
S: Tolerated / 0.002 / 0.016 / 0.13
CD276 / rs11552770 / 15:74001993 / Exon / c.855TC / p.Ala285Ala / Synonymous / N/A / 0.078 / 0.38
CSF1 / rs56222520 / 1:110452920 / Upstream / c.-391-335G>A / G: c-REL / 0.006 / 0.036 / 0
CNOT4 / rs17480616 / 7:135123060 / Exon / c.20C>G / p.Ala7Gly / Conservative / P: Benign
S: Tolerated / 0.022 / 0.015 / 0
CNOT4 / rs189512250 / 7:135095430 / Intron / c.688-32C>T / B: Broken site / 0.017 / 0.017 / 0
CNOT4 / rs149338747 / 7:135095260 / Intron / c.821+5G>A / 0.028 / 0.033 / 0
CNOT4 / rs74840326 / 7:135080323 / Intron / 2:c.1129+63A>C / B: New site / 0.033 / 0.033 / 0
CTHRC1 / rs72124849 / 8:104388290-104388294 / Intron / c.372+103_372+107delAAAAA / N/A / 0.040 / 0
CTHRC1 / rs35500845 / 8:104388446 / Intron / c.372+259A>G / S: New site / 0.049 / 0.15 / 0
EPS8L3 / rs58548898 / 1:110295553 / Intron / c.1203+186G>A / S: New site / 0.043 / 0.047 / 0
EPS8L3 / rs143958216 / 1:110305247-110305250 / Intron / c.-24-855_-24-852delAGTA / S: New site / N/A / 0.31 / 0
EPS8L3 / rs146407630 / 1:110304938 / Intron / c.-24-543C>T / G: c-FOS / N/A / 0.047 / 0.13
EPS8L3 / rs77854863 / 1:110302505 / Intron / c.97-47C>T / 0.034 / 0.033 / 0
EPS8L3 / rs17598321 / 1:110302450 / Exon / c.105G>A / p.Met35Ile / Conservative / P: Benign
S: Tolerated / L: CREB / 0.014 / 0.050 / 0.13
EPS8L3 / rs3831143 / 1:110301430 / Intron / c.462-142delG / N/A / 0.20 / 0.13
GOLGA6A / rs201579908 / 15:74372981 / Exon / c.180C>T / p. Ser 60 Ser / Synonymous / G:E2 / N/A / 0.019 / 0
GOLGA6A / rs199674700 / 15:74363700 / Intron / c.1800+8G>A / 0.008 / 0.19 / 0.20
GOLGA6A / rs199760693 / 15:74363667 / Intron / c.1800+41G>A / 0.003 / 0.03 / 0.20
GSTM3 / rs186464486 / 1:110282448 / Intron / c.124+7C>T / N/A / 0.030 / 0
GSTM3 / rs41283504 / 1:110280680 / Intron / c.372+33A>C / G: CREB / S: Broken site / 0.005 / 0.016 / 0
GSTM3 / ESP_1_110279822 / 1:110279822 / Intron / c.580-31C>T / N/A / 0.016 / 0
GSTM3 / rs58210492 / 1:110280255 / Intron / c.465+21_465+23delCTC / N/A / 0.14 / 0.25
GSTM4 / rs115450622 / 1:110195901 / Upstream / c.-309-2802T>C / 0.034 / 0.067 / 0.13
GSTM4 / rs116014876 / 1:110200131 / Intron / c.178-81C>T / B: Broken site / 0.010 / 0.047 / 0.13
GSTM4 / rs650985 / 1:110201580 / Intron / c.457-42C>T / 0.023 / 0.076 / 0
GSTM4 / rs75484590 / 1:110201860 / Intron / c.567+128C>A / 0.033 / 0.061 / 0.13
GSTM4 / rs142639069 / 1:110204227 / 3' UTR / c.*351C>T / L: C/EBPβ / N/A / 0.016 / 0
GSTM4 / 1KG_1_110196104 / 1:110196104 / Upstream / c.-309-2599A>G / S: New site / 0.001 / 0.017 / 0
GSTM4 / rs140934911 / 1:110199617 / Intron / c.112+208T>A / S Broken site
S: New site / N/A / 0.018 / 0
LRP12 / rs116702656 / 8:105543942 / Intron / c.136+193G>A / 0.016 / 0 / 0.13
LRP12 / 1KG_8_105509700 / 8:105509700 / Exon / c.1080T>C / p.Asn360Asn / Synonymous / 0.002 / 0.033 / 0
NUP205 / rs62479496 / 7:135242451 / Upstream / c.-26-216A>G / 0.025 / 0.034 / 0.25
NUP205 / rs117892953 / 7:135242747 / Intron / c.28+27T>C / B: Broken site
S: New site / 0.025 / 0.017 / 0
NUP205 / rs12539427 / 7:135261009 / Intron / c.344-9C>G / 0.042 / 0.10 / 0.25
NUP205 / rs12531882 / 7:135261229 / Intron / c.488+67T>G / 0.049 / 0.10 / 0.25
NUP205 / rs59242940 / 7:135261948 / Intron / c.648+72G>A / 0.042 / 0.11 / 0.25
NUP205 / rs201238624 / 7:135262802 / Intron / c.877+29insA / S: Broken / N/A / 0.094 / 0.25
NUP205 / rs73725144 / 7:135263709 / Intron / c.1042+46C>G / 0.042 / 0.10 / 0.25
NUP205 / rs58392569 / 7:135269655 / Exon / c.1118T>C / p.Met373Thr / Radical / P: Benign
S: Tolerated / 0.042 / 0.088 / 0.17
NUP205 / rs61459701 / 7:135269656 / Exon / 6:c.1119G>A / p.Met373Ile / Conservative / P: Benign
S: Tolerated / 0.042 / 0.088 / 0.17
NUP205 / rs117136012 / 7:135277664 / Intron / c.1625-71A>G / S: New site / 0.017 / 0.065 / 0
NUP205 / rs75910356 / 7:135277716 / Intron / c.1625-19G>T / 0.042 / 0.097 / 0.13
NUP205 / rs73725163 / 7:135282995 / Intron / c.2274+40A>G / 0.042 / 0.065 / 0
NUP205 / rs35467082 / 7:135286170 / Exon / c.2427G>A / p.Leu809Leu / Synonymous / 0.017 / 0.097 / 0.13
NUP205 / rs73725183 / 7:135291726 / Intron / c.3070+63A>C / B: Broken site / 0.042 / 0.11 / 0.25
NUP205 / rs138701914 / 7:135291799 / Intron / c.3070+136delT / S: Broken site
S: New site / N/A / 0.11 / 0.25
NUP205 / rs61734146 / 7:135292080 / Exon / c.3156G>A / p.Ala1052Ala / Synonymous / 0.042 / 0.12 / 0.25
NUP205 / rs78081135 / 7:135300902 / Intron / c.3460+89T>C / B: Broken site / 0.033 / 0.029 / 0.13
NUP205 / rs73725198 / 7:135300921 / Intron / c.3460+108C>T / 0.042 / 0.088 / 0.25
NUP205 / rs56870118 / 7:135301325 / Intron / c.3461-78G>A / B: Broken site / 0.042 / 0.10 / 0.25
NUP205 / rs35690290 / 7:135301522 / Intron / c.3532+48delA / N/A / 0.50 / 0.50
NUP205 / rs12538982 / 7:135302594 / Intron / c.3771+164T>C / B: Broken site / 0.042 / 0.091 / 0.25
NUP205 / rs140215067 / 7:135311074 / Exon / c.4758A>C / p.Gln1586His / Radical / P: Benign
S: Tolerated / 0.001 / 0.015 / 0
NUP205 / rs76919188 / 7:135333083 / Intron / c.5887-69G>A / S: Broken / 0.033 / 0.065 / 0
NUP205 / rs61740269 / 7:135333172 / Exon / c.5907C>T / p.Asn1969Asn / Synonymous / L: C/EBPβ / 0.042 / 0.11 / 0.33
PML / rs2301273 / 15:74286882 / Upstream / c.-96-176C>T / G: NRF-2 / 0.013 / 0.036 / 0
PML / rs57156757 / 15:74335307 / Intron / c.1711-23C>T / 0.008 / 0.059 / 0
PML / rs201804134 / 15:74327660 / Intron / c.1710+789C>G / L: Sp1 / N/A / 0.015 / 0
PML / rs743582 / 15:74328206 / Intron / c.1710+1335G>C / G : C/EBPβ / S: New site / 0.042 / 0.091 / 0
PML / rs61751123 / 15:74336725 / Exon / 3:c.2025C>T / p.Ala675Ala / Synonymous / 0.025 / 0.076 / 0
PML / EPS_15_74336849 / 15:74336849 / Exon / c.2149C>T / p.Arg717Cys / Radical / P: Benign
S: Tolerated / N/A / 0.015 / 0
PSMA5 / rs116711017 / 1:109968616 / Intron / c.29+308G>A / G: c-FOS
L: PPARgamma / B: Broken site
S: Broken site / 0.009 / 0.017 / 0
PSMA5 / rs12118385 / 1:109953510 / Intron / c.561+123C>T / 0.009 / 0.016 / 0
TM7SF4 / rs2458417 / 8:105351191 / Upstream / c.-50-863G>A / G: c-REL / N/A / 0.016 / 0
TM7SF4 / rs77194116 / 8:105367370 / Exon / c.1295C>T / p.Pro432Leu / Radical / P: Benign
S: Tolerated / 0.014 / 0 / 0.13
TM7SF4 / rs118038136 / 8:105351490 / Upstream / c.-50-564G>T / S: Broken site / 0.008 / 0.029 / 0
TM7SF4 / rs61682032 / 8:105360994 / Exon / c.214C>A / p.Leu72Met / Conservative / P: Probably damaging
S: Deleterious / 0.027 / 0 / 0.13
TM7SF4 / rs144377739 / 8:105361740 / Exon / c.960C>T / p.Leu320Leu / Synonymous / N/A / 0.016 / 0
TM7SF4 / rs117086639 / 8:105361803 / Exon / c.1023C>T / p.His341His / Synonymous / 0.014 / 0 / 0.13
TM7SF4 / rs62620995 / 8:105367264 / Exon / c.1189C>T / p.Leu397Phe / Radical / P: Probably damaging
S: Tolerated / 0.014 / 0.019 / 0
TM7SF4 / rs201469150 / 8:105367308 / Exon / c.1233C>T / p.Ser411Ser / Synonymous / 0.001 / 0 / 0.13
UBL7 / rs35032603 / 15:74753425 / Intron / c.-30+24A>G / N/A / 0.060 / 0.25
UBL7 / rs80343857 / 15:74750946 / Intron / c.184+79A>G / B: Broken site / 0.042 / 0.037 / 0.13
UBL7 / rs147593058 / 15:74741686 / Exon / c.723G>A / p.Arg241Arg / Synonymous / 0.011 / 0.016 / 0
* Genomic and gene locations according to 1000 genomes database (first transcript). MAF= minor allele frequency.
1
References
Agarwal S, Harada J, Schreifels J, Lech P, Nikolai B, Yamaguchi T, Chanda SK, Somia NV (2006) Isolation, characterization, and genetic complementation of a cellular mutant resistant to retroviral infection. Proc Natl Acad Sci U S A 103: 15933-8. doi: 10.1073/pnas.0602674103
Albagha OM, Visconti MR, Alonso N, Langston AL, Cundy T, Dargie R, Dunlop MG, Fraser WD, Hooper MJ, Isaia G, Nicholson GC, del Pino Montes J, Gonzalez-Sarmiento R, di Stefano M, Tenesa A, Walsh JP, Ralston SH (2010) Genome-wide association study identifies variants at CSF1, OPTN and TNFRSF11A as genetic risk factors for Paget's disease of bone. Nat Genet 42: 520-4. doi: ng.562 [pii]
Albagha OM, Wani SE, Visconti MR, Alonso N, Goodman K, Brandi ML, Cundy T, Chung PY, Dargie R, Devogelaer JP, Falchetti A, Fraser WD, Gennari L, Gianfrancesco F, Hooper MJ, Van Hul W, Isaia G, Nicholson GC, Nuti R, Papapoulos S, Montes Jdel P, Ratajczak T, Rea SL, Rendina D, Gonzalez-Sarmiento R, Di Stefano M, Ward LC, Walsh JP, Ralston SH (2011) Genome-wide association identifies three new susceptibility loci for Paget's disease of bone. Nat Genet 43: 685-9. doi: ng.845 [pii]
Albert TK, Hanzawa H, Legtenberg YI, de Ruwe MJ, van den Heuvel FA, Collart MA, Boelens R, Timmers HT (2002) Identification of a ubiquitin-protein ligase subunit within the CCR4-NOT transcription repressor complex. EMBO J 21: 355-64. doi: 10.1093/emboj/21.3.355
Behrends C, Sowa ME, Gygi SP, Harper JW (2010) Network organization of the human autophagy system. Nature 466: 68-76. doi: 10.1038/nature09204
Beverdam A, Brouwer A, Reijnen M, Korving J, Meijlink F (2001) Severe nasal clefting and abnormal embryonic apoptosis in Alx3/Alx4 double mutant mice. Development 128: 3975-86.
Caetano-Lopes J, Canhao H, Fonseca JE (2009) Osteoimmunology--the hidden immune regulation of bone. Autoimmun Rev 8: 250-5. doi: 10.1016/j.autrev.2008.07.038
Chang YG, Song AX, Gao YG, Shi YH, Lin XJ, Cao XT, Lin DH, Hu HY (2006) Solution structure of the ubiquitin-associated domain of human BMSC-UbP and its complex with ubiquitin. Protein Sci 15: 1248-59. doi: 10.1110/ps.051995006
Chapoval AI, Ni J, Lau JS, Wilcox RA, Flies DB, Liu D, Dong H, Sica GL, Zhu G, Tamada K, Chen L (2001) B7-H3: a costimulatory molecule for T cell activation and IFN-gamma production. Nat Immunol 2: 269-74. doi: 10.1038/85339
Chung PY, Beyens G, Boonen S, Papapoulos S, Geusens P, Karperien M, Vanhoenacker F, Verbruggen L, Fransen E, Van Offel J, Goemaere S, Zmierczak HG, Westhovens R, Devogelaer JP, Van Hul W (2010) The majority of the genetic risk for Paget's disease of bone is explained by genetic variants close to the CSF1, OPTN, TM7SF4, and TNFRSF11A genes. Hum Genet 128: 615-26. doi: 10.1007/s00439-010-0888-2
Gallet M, Mentaverri R, Sevenet N, Brazier M, Kamel S (2006) Ability of breast cancer cell lines to stimulate bone resorbing activity of mature osteoclasts correlates with an anti-apoptotic effect mediated by macrophage colony stimulating factor. Apoptosis 11: 1909-21. doi: 10.1007/s10495-006-9507-z
Grandi P, Dang T, Pane N, Shevchenko A, Mann M, Forbes D, Hurt E (1997) Nup93, a vertebrate homologue of yeast Nic96p, forms a complex with a novel 205-kDa protein and is required for correct nuclear pore assembly. Mol Biol Cell 8: 2017-38.
Guo A, Salomoni P, Luo J, Shih A, Zhong S, Gu W, Pandolfi PP (2000) The function of PML in p53-dependent apoptosis. Nat Cell Biol 2: 730-6. doi: 10.1038/35036365
Huang J, Dorsey J, Chuikov S, Perez-Burgos L, Zhang X, Jenuwein T, Reinberg D, Berger SL (2010) G9a and Glp methylate lysine 373 in the tumor suppressor p53. J Biol Chem 285: 9636-41. doi: 10.1074/jbc.M109.062588
Javed A, Guo B, Hiebert S, Choi JY, Green J, Zhao SC, Osborne MA, Stifani S, Stein JL, Lian JB, van Wijnen AJ, Stein GS (2000) Groucho/TLE/R-esp proteins associate with the nuclear matrix and repress RUNX (CBF(alpha)/AML/PEBP2(alpha)) dependent activation of tissue-specific gene transcription. J Cell Sci 113 ( Pt 12): 2221-31.
Jensen ED, Gopalakrishnan R, Westendorf JJ (2010) Regulation of gene expression in osteoblasts. Biofactors 36: 25-32. doi: 10.1002/biof.72
Karsenty G (2008) Transcriptional control of skeletogenesis. Annu Rev Genomics Hum Genet 9: 183-96. doi: 10.1146/annurev.genom.9.081307.164437
Karsenty G, Kronenberg HM, Settembre C (2009) Genetic control of bone formation. Annu Rev Cell Dev Biol 25: 629-48. doi: 10.1146/annurev.cellbio.042308.113308
Kimura H, Kwan KM, Zhang Z, Deng JM, Darnay BG, Behringer RR, Nakamura T, de Crombrugghe B, Akiyama H (2008) Cthrc1 is a positive regulator of osteoblastic bone formation. PLoS One 3: e3174. doi: 10.1371/journal.pone.0003174
Kubota T, Michigami T, Ozono K (2009) Wnt signaling in bone metabolism. J Bone Miner Metab 27: 265-71. doi: 10.1007/s00774-009-0064-8
Liu S, Yu Y, An H, Li N, Lin N, Wang W, Zhang W, Wan T, Cao X (2003) Cloning and identification of a novel ubiquitin-like protein, BMSC-UbP, from human bone marrow stromal cells. Immunol Lett 86: 169-75.
Luo W, Gangwal K, Sankar S, Boucher KM, Thomas D, Lessnick SL (2009) GSTM4 is a microsatellite-containing EWS/FLI target involved in Ewing's sarcoma oncogenesis and therapeutic resistance. Oncogene 28: 4126-32. doi: 10.1038/onc.2009.262
Marie PJ (2008) Transcription factors controlling osteoblastogenesis. Arch Biochem Biophys 473: 98-105. doi: 10.1016/j.abb.2008.02.030
McNaught KS, Olanow CW, Halliwell B, Isacson O, Jenner P (2001) Failure of the ubiquitin-proteasome system in Parkinson's disease. Nat Rev Neurosci 2: 589-94. doi: 10.1038/35086067
Mellis DJ, Itzstein C, Helfrich MH, Crockett JC (2011) The skeleton: a multi-functional complex organ: the role of key signalling pathways in osteoclast differentiation and in bone resorption. J Endocrinol 211: 131-43. doi: 10.1530/JOE-11-0212
Mersman DP, Du HN, Fingerman IM, South PF, Briggs SD (2009) Polyubiquitination of the demethylase Jhd2 controls histone methylation and gene expression. Genes Dev 23: 951-62. doi: 10.1101/gad.1769209
Mirasierra M, Fernandez-Perez A, Diaz-Prieto N, Vallejo M (2011) Alx3-deficient mice exhibit decreased insulin in beta cells, altered glucose homeostasis and increased apoptosis in pancreatic islets. Diabetologia 54: 403-14. doi: 10.1007/s00125-010-1975-6
Rosen CJ (2008) Bone remodeling, energy metabolism, and the molecular clock. Cell Metab 7: 7-10. doi: 10.1016/j.cmet.2007.12.004
Salinas-Souza C, Petrilli AS, de Toledo SR (2010) Glutathione S-transferase polymorphisms in osteosarcoma patients. Pharmacogenet Genomics 20: 507-15. doi: 10.1097/FPC.0b013e32833caa45
Sato K, Suematsu A, Nakashima T, Takemoto-Kimura S, Aoki K, Morishita Y, Asahara H, Ohya K, Yamaguchi A, Takai T, Kodama T, Chatila TA, Bito H, Takayanagi H (2006) Regulation of osteoclast differentiation and function by the CaMK-CREB pathway. Nat Med 12: 1410-6. doi: 10.1038/nm1515
Suh WK, Wang SX, Jheon AH, Moreno L, Yoshinaga SK, Ganss B, Sodek J, Grynpas MD, Mak TW (2004) The immune regulatory protein B7-H3 promotes osteoblast differentiation and bone mineralization. Proc Natl Acad Sci U S A 101: 12969-73. doi: 10.1073/pnas.0405259101
Trynka G, Zhernakova A, Romanos J, Franke L, Hunt KA, Turner G, Bruinenberg M, Heap GA, Platteel M, Ryan AW, de Kovel C, Holmes GK, Howdle PD, Walters JR, Sanders DS, Mulder CJ, Mearin ML, Verbeek WH, Trimble V, Stevens FM, Kelleher D, Barisani D, Bardella MT, McManus R, van Heel DA, Wijmenga C (2009) Coeliac disease-associated risk variants in TNFAIP3 and REL implicate altered NF-kappaB signalling. Gut 58: 1078-83. doi: 10.1136/gut.2008.169052
van Wijk SJ, de Vries SJ, Kemmeren P, Huang A, Boelens R, Bonvin AM, Timmers HT (2009) A comprehensive framework of E2-RING E3 interactions of the human ubiquitin-proteasome system. Mol Syst Biol 5: 295. doi: 10.1038/msb.2009.55
Winkler GS, Albert TK, Dominguez C, Legtenberg YI, Boelens R, Timmers HT (2004) An altered-specificity ubiquitin-conjugating enzyme/ubiquitin-protein ligase pair. J Mol Biol 337: 157-65. doi: 10.1016/j.jmb.2004.01.031
Wise GE, Yao S, Odgren PR, Pan F (2005) CSF-1 regulation of osteoclastogenesis for tooth eruption. J Dent Res 84: 837-41.
Yagi M, Miyamoto T, Sawatani Y, Iwamoto K, Hosogane N, Fujita N, Morita K, Ninomiya K, Suzuki T, Miyamoto K, Oike Y, Takeya M, Toyama Y, Suda T (2005) DC-STAMP is essential for cell-cell fusion in osteoclasts and foreign body giant cells. J Exp Med 202: 345-51. doi: 10.1084/jem.20050645
Yang X, Karsenty G (2002) Transcription factors in bone: developmental and pathological aspects. Trends Mol Med 8: 340-5.
Zhong S, Salomoni P, Ronchetti S, Guo A, Ruggero D, Pandolfi PP (2000) Promyelocytic leukemia protein (PML) and Daxx participate in a novel nuclear pathway for apoptosis. J Exp Med 191: 631-40.
1