Supplementary Table 1. Primers used for verification of SNPs identified from Next-Gen Sequencing and identification of SNPs in the diploid recombinants.

Name / Sequence (5’ 3’) / Use
PG-132.1-f / GCCAGCTGATTCTCTTCTTAC / Screening for mutations in diploids
PG-132.1-r / CAGACAAATGGAAGTGGGTTC / Screening for mutations in diploids
PG-132.2-f / CTGCCCTTAATACATACGTTATAC / Screening for mutations in diploids
PG-132.2-r / CATTGCTCTGAGGGCTCATAAC / Screening for mutations in diploids
PG-132.3-f / TCCATTAACGACTTTGACGTC / Screening for mutations in diploids
PG-132.3-r / GCGTTTGTGACAAGAAGTAAT G / Screening for mutations in diploids
PG-132.4-f / CAATGTCCAGTTGAGCCACC / Screening for mutations in diploids
PG-132.4-r / CAGAAGAAGTATTCGAACTGAGG / Screening for mutations in diploids
PG-164.1-f / TGATCCCACCACCATGGTC / Screening for mutations in diploids
PG-164.1-r / TGATCCCACCACCATGGTA / Screening for mutations in diploids
PG-259.1-f / CGCTCTCATGGGTCAAGATAA / Screening for mutations in diploids
PG-259.1-r / AGGTAGAAGAGGGTCAGCAC / Screening for mutations in diploids
PG-259.2-f / CTACGCATATGGTTTCAAGATC / Screening for mutations in diploids
PG-259.2-r / GTACCACCAGTGGATTGCAC / Screening for mutations in diploids
PG-259.3-f / GCCAGATCCAAAGTAGCCTTAG / Screening for mutations in diploids
PG-259.3-r / CGATTGACACAGAGGCATGTTC / Screening for mutations in diploids
PG-259.4-f / GCCTTCTGCCAAAGAGGTTAA / Screening for mutations in diploids
PG-259.4-r / AGACATATTAGGCATCAGAGG / Screening for mutations in diploids
PG-259.5-f / GCGCTAGGGTGAAGAGAGTTA / Screening for mutations in diploids
PG-259.5-r / GTTGTTGGCGTGTGCATTT / Screening for mutations in diploids
PG-259.6-f / GACATTGTTTCCGTAGCTTTA CC / Screening for mutations in diploids
PG-259.6-r / TATGCACGCTCCACTTACTCC / Screening for mutations in diploids
PG-353.1-f / TCTTGTTGGGCGAAAACAGAG / Screening for mutations in diploids
PG-353.1-f / TGAAAATTATCCTGGGCTGCA / Screening for mutations in diploids
PR-438.1-f / GACTTCAATACAGTCTTCGAACCAAA / Screening for mutations in diploids
PR-438.1-r / TCCTTATACAGCTGCTGTTACAAT T / Screening for mutations in diploids
PR-438.2-f / GACTTCAATACAGTCTTCGAACCAAC / Screening for mutations in diploids
PR-438.2-r / TCCTTATACAGCTGCTGTTACAAT T / Screening for mutations in diploids

Supplementary Fig. 1. An example of growth data used to calculate maximum specific growth rates. The data shown is from measurements of the OD600taken in a 96-well plate using a TECAN plate reader for the growth of the wild-type GFP-RFP diploid in YNB media. The growth curve is qualitatively representative of other growth curves obtained in this work. Empty circles are ln(OD600) for the complete growth curve; filled triangles for the exponential phase only, and the solid line is a fit of a linear equation to the exponential phase. Exponential phase was defined by truncating initial data to a point with a maximum R2 value for a linear fit was found (lag phase) and truncating data after a maximum difference in OD600 between seven data points was found (stationary phase). The R2 value for the exponential fit to the exponential phase is 0.987 using the following equation.

Supplementary Fig. 2. Relative fitness of parental diploids in the presence of various inhibitors. The maximum specific growth rates of each recombinantwere compared to the wild-type GFP-RFP control strain in the presence of individual inhibitors and in a mixture of all three (synthetic hydrolysates). Asterisk indicates statistical significance between mating products and wild-type GFP-RFP with a P-value < 0.05 (two-tailed student’s t-test, unequal variances.) Two asterisks indicate at least three replicates under this condition were unable to grow or unable to reach stationary phase within 34 hours. Error bars represent ± standard deviation. PMM1 exhibited a 13% increase in fitness relative to the wild-type GFP-RFP in the presence of furfural. PMM3 and PMM4 exhibited a 37% and 100% increase in relative fitness in the presence of HMF, respectively.

Supplementary Fig. 3. Growth rate of wild-typeGFP-RFP in YNB media compiled from two independent experiments with three replicates each. Error bars represent ± standard deviation.

1