Supplementary table 1. Primer set used for the pyrosequencing analysis of SNPs of C2 gene

Primer name / Sequences (5′→ 3′) / Annealing Temp
C2 F (Biotin) / ACAAAGTCACGTTCCCCAAC / 64℃
C2 R / CTTCTCTGGAATCCAGGCTC
C2 M / TCACCACCTCTCTGACAT

Supplementary table 2.The 14 SNP markers with genome-wide level of significance (PBonferroni < 0.01)

SSC / SNP ID / Location / A1 / MAF / GC corrected P-values
3 / H3GA0009813 / 60229784 / C/T / 0.49 / 6.64E-05
5 / ASGA0025233 / 28861471 / T/C / 0.06 / 7.21E-05
5 / ALGA0031518 / 29507417 / C/A / 0.06 / 7.21E-05
7 / DIAS0002191 / 27792678 / G/A / 0.36 / 7.72E-05
3 / ASGA0103234 / 23017097 / A/G / 0.05 / 9.84E-05
14 / H3GA0041116 / 83868105 / G/A / 0.22 / 0.00018
7 / DRGA0007412 / 30455510 / C/T / 0.21 / 0.00029
7 / ASGA0032151 / 30341935 / C/T / 0.21 / 0.00029
15 / ALGA0084616 / 26628304 / C/A / 0.38 / 0.00029
5 / MARC0049197 / 13531717 / G/T / 0.13 / 0.00030
5 / ALGA0030818 / 14017908 / G/A / 0.13 / 0.00030
3 / MARC0081581 / 24571716 / C/T / 0.06 / 0.00031
12 / ASGA0094812 / 51682727 / T/C / 0.13 / 0.00035
7 / ASGA0035905 / 115538128 / C/T / 0.47 / 0.00035

Supplementary table 3.Genotypic association of single nucleotide polymorphisms (SNPs) with Ca++ trait in an intercross population between KNP and Landrace

Trait / SNP / Chr. / Location / Allele (major/minor) / MAF / Pdom1 / Pcorr2 / Padd3 / Prec4
Ca++ / C2 / 7 / 27855172 / T/C / 0.33 / 5.910-5 / 2.610-4 / 6.910-4 / 0.20
DIAS0002191 / 7 / 27792678 / G/A / 0.36 / 7.710-5 / 4.610-4 / 8.610-4 / 0.21

Chr: chromosome, MAF: minor allele frequency

1,3,4Genomic control corrected P-value estimated with dominant, additive, and recessive genotypic models.

2P-value adjusted by the Bonferroni multiple test.
Supplementary table 4.Genotypic distributions of c.1963A<G (N655D), c.91G<T (A31S), and DIAS0002191 in the F0 generation of KNP and Landrace intercross

SNP / Genotype / Korean native pig / Landrace
c.1963A<G (N655D) / T/T / 3 / 2
T/C / 11 / 4
C/C / 4 / 10
c.91G<T (A31S) / G/G / 13 / 16
G/T / 5 / 0
T/T / 0 / 0
DIAS0002191 / G/G / 3 / 2
G/A / 10 / 6
A/A / 5 / 7

Supplementary table 5.Allele and genotype frequencies for the polymorphisms of C.1963A<G (N655D) in the C2 gene and DIAS0002191 in F0 parental breeds

SNP / KNP / Landrace
Allele
frequency / Genotype frequency / Allele
frequency / Genotype frequency
c.1963A<G (N655D) / T / C / TT / TC / CC / T / C / TT / TC / CC
0.47 / 0.53 / 0.17 / 0.61 / 0.22 / 0.25 / 0.75 / 0.125 / 0.25 / 0.625
DIAS0002191 / G / A / GG / GA / AA / G / A / GG / GA / AA
0.44 / 0.56 / 0.17 / 0.55 / 0.28 / 0.33 / 0.67 / 0.13 / 0.40 / 0.47

1