Supplementary Materials, Methods and Figures

Supplementary materials, methods and figures

Plasmids construction

Full length human dysbindin-1 cDNA was amplified, using a human adult brain cDNA library as the template, by PCR with primers 5’-GAAGATCTGCAATGCTGGAGACCCTTC-3’ and 5’-CCGGAATTCAAAGAGTCGCTGTCCTC-3’. The PCR product was inserted in-frame into pEGFP-N3 (Clontech, Mountair View, CA, USA) at BglII/EcoRI sites. pGEX-5x-1-dysbindin-1 was constructed by subcloning the PCR product, amplified with primers 5’-CGGGATCCCAATGCTGGAGACCCTTC-3’ and 5’-CCGCTCGAGTTAAGAGTCGCTGTCCTC-3’, into pGEX-5x-1 (Amersham Biosciences, Peapack, NJ, USA). p3×Flag-myc-CMV-24-dysbindin-1 and pKH3-dysbindin-1 were obtained by digesting dysbindin-1 cDNA from pcDNA3.1/V5-HisA-dysbindin-1 at HindIII/XbaI sites and inserting in-frame into p3×Flag-myc-CMV-24 (Sigma, Saint Louis, MO, USA) and pKH3 (Addgene, Cambridge, MA, USA) at the same sites, respectively. For generating constructs expressing the N-terminus (amino acids 1-217) of dysbindin-1, we cut out the fragment of dysbindin-1 cDNA (nucleotide 1-651) from pEGFP-N3-dysbindin-1 at BglII/PstI sites, then subcloned this fragment into pEGFP-N1 (Clontech, Mountair View, CA, USA) at the same sites. For generating a construct expressing the C-terminus (amino acids 216-351) of dysbindin-1, we digested the fragment of dysbindin-1 cDNA (nucleotides 646-1056) from pGEX-5x-1-dysbindin-1 at PstI/XhoI sites and inserted it into pcDNA4-HisA (Invitrogen, Carlsbad, CA, USA) at the same sites. Subsequently, we excised this fragment from pcDNA4-HisA-dysbindin-1 at BamHI/XhoI sites and inserted it into pEGFP-C2 (Clontech, Mountair View, CA, USA) at BglII/SalI sites. For generating a construct expression the dysbindin-1 with a deletion of leucine zipper motif (LZM), we deleted the amino acids 97-118 (nucleotides 289-354) from pEGFP-N3-dysbindin-1 by using Site-Directed Mutagenesis kit (Takara, Otsu, Shiga, Japan), with primers 5’-ACTCATTTAGAGGCGAG-3’ and 5’-CTCCACGAGGCTTGTCTTTTTC-3’. pEGFP-N3-dysbindin-1∆CCD, a coiled-coil domain deletion mutant, was constructed using Site-Directed Mutagenesis kit (Takara, Otsu, Shiga, Japan) with primers 5’-CAAATGAAGCTGAAGGAG-3’and 5’- CTCCCAGTGCGCAGAAAG-3’ to delete amino acids 89-188 (nucleotides 265-564). pGBKT7-dysbindin-1-(1-189) was constructed by subcloning the PCR product, amplified with primers 5’-CGGGATCCCAATGCTGGAGACCCTTC-3’ and 5’-ACGCGTCGACTTATTGCTGGGTGTGCTC-3’, into pGBKT7 (Clontech, Mountair View, CA, USA) at BamHI/SalI site.

Plasmid containing full length of mouse necdin cDNA was a gift from Dr. Chenming Fan (Department of Embryology, Carnegie Institution of Washington). p3×Flag-myc-CMV-24-necdin and pKH3-necdin were constructed by subcloning the PCR product, amplified with primers 5’-CCCAAGCTTCCCATGTCGGAACAAAGTAAG-3’ and 5’-CGACGTCGACGTCCTCAGAGACACTGCTG-3’, into p3×Flag-myc-CMV-24 or pKH3 at HindШ/SalI sites. pET-21a-necdin and pGEX-5x-1-necdin were constructed by subcloning the PCR product, amplified with primers 5’-CGGAATTCCCCATGTCGGAACAAAGTAAG-3’ and 5’-CGACGTCGACGTCCTCAGAGACACTGCTG-3’, into pET-21a (Novagen, Darmstadt, Germany) or pEGX-5x-1 (Amersham Biosciences, Peapack, NJ, USA) at EcoRI/SalI sites. pGADT7-necdin was obtained by excising necdin cDNA from pGEX-5x-1-necdin at EcoRI/XhoI sites and inserting in-frame into pGADT7 (Clontech, Mountair View, CA, USA).

Full length human p53 cDNA was first obtained by PCR from a human fetal brain cDNA library (Clonetech) with primers 5’-CCGCTCGAGATGGAGGAGCCGCAGTC-3’ and 5’-CGCGGATCCTCAGTCTGAGTCAGG-3’, and then inserted into p3×Flag-myc-CMV24 vector. pEGFP-N1-p53 was described previously (1).

The fidelity of all constructs was confirmed by sequencing.

Yeast two-hybrid screen and yeast growth assay

pGBKT7-dysbindin-1-(1-189) was used as the bait plasmid for screening a human fetal brain cDNA library (Clontech, Mountair View, CA, USA). Reagents needed in the yeast two-hybrid screen were all purchased from Clontech. The yeast two-hybrid screen procedure was performed according to the manufacturer’s recommendations. In briefly, a yeast strain AH109 containing pGBKT7-dysbindin-1-(1-189) was hybridized with a yeast strain Y187that was pretransformedwith a human fetal brain cDNA library. The mating mixtures were spread onto the plates with a minimal medium lacking leucine, tryptophan and histidine. Yeast clones that grew on the plates were then spotted to the plates with a more restricted minimal medium lacking leucine, tryptophan, histidine and adenine for a further screening. The β-galactosidase activity assay was performed according to the manufacturer’s manual. The cDNA from positive clones were extracted and subjected to sequencing.

For yeast growth assay, plasmids were transformed into yeast strain AH109. Yeast transformants were then spread onto the plates with a minimal medium lacking leucine and tryptophan. Grown clones were then spotted onto the plates with a minimal medium lacking leucine, tryptophan and histidine (3-Amino-1,2,4-triazole was added to inhibit the auto- activation of histidine gene) or a minimal medium lacking leucine, tryptophan, histidine and adenine. The growth of yeast clones were observed after three days.

GST pulldown assay

An aliquot containing 20 μg GST or GST-dysbindin-1 that was expressed in Escherichia coli strain JM109 was incubated with 30 μl of Glutathione Sepharose 4B (Amersham Biosciences, Peapack, NJ, USA) for 30 minutes at 4C. Sepharose bound with GST or GST-dysbindin-1 was incubated with 50 μg of His-necdin protein from the supernatants of E. coli crude extract containing His-tagged proteins in 0.25 ml HNTGbuffer (20 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 0.1% Triton X-100, and 10% glycerol) for one hour at 4C. After incubation, the beads were washed five times with 1 ml HNTG buffer to remove unbound proteins. Bound proteins were eluted by boiling in SDS sample buffer and subjected to immunoblot analysis.

Immunoprecipitation

HEK293 cells or N2a cells transfected with EGFP-tagged constructs were collected 48 hours after transfection. The cells were sonicated in cell lysis buffer containing 50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate and a protein inhibitor cocktail (Roche, Mannheim, Germany). Cellular debris was removed by centrifugation at 12,000 g for 30 minutes at 4C. The supernatants were incubated with polyclonal anti-EGFP antibodies (for immunoprecipitating EGFP fused protein) (Santa Cruz Biotechnology, Santa Cruz, CA, USA) or polyclonal anti-dysbindin-1 antiserum(2) (for immunoprecipitating endogenous dysbindin-1) for 1 hour at 4C. After incubation, protein G Agarose (Roche, Mannheim, Germany) was used for precipitation. The beads were washed with cell lysis buffer four times, and then bound proteins were eluted with SDS sample buffer for immunoblot analysis.

Immunoblot analysis

Proteins were subjected to 10% SDS-PAGE and then transferred onto polyvinylidene difluoride membrane (Millipore, Billerica, MA, USA). The following primary antibodies were used: polyclonal anti-dysbindin-1 antiserum (2),polyclonal anti-ERK1 antibodies (Santa Cruz Biotechnology, Santa Cruz, CA, USA), monoclonal anti-EGFP antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA), monoclonal anti-Flag or anti-Flag-HRP antibody (Sigma, Saint Louis, MO, USA), monoclonal anti-GAPDH antibody (Millipore, Billerica, MA, USA), monoclonal anti-HA antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA), monoclonal anti-His antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA), and monoclonal anti-p21 antibody (Sigma, St Louis, MO, USA). Sheep anti-mouse IgG-HRP antibody or anti-rabbit IgG-HRP antibody (Amersham Pharmacia Biotech, Peapack, NJ, USA) was used as the secondary antibody. The proteins were visualized by using an ECL detection kit (Amersham Pharmacia Biotech, Peapack, NJ, USA).

Immunocytochemistry

HEK293 cells transfected with EGFP-tagged or HA-tagged expression vectors grown on cover slides were washed with PBS and then fixed with 4% paraformaldehyde for 5 minutes at room temperature. The fixed cells were incubated with 0.25% Triton X-100 for 5 minutes and blocked with 1% FBS in PBS and then incubated overnight at 4°C with anti-HA antibody followed by an incubation with Rhodamine-conjugated donkey anti-mouse antibodies (Santa Cruz Biotechnology, Santa Cruz, CA, USA). The nuclei were stained with Hoechst 33342 (Sigma, Saint Louis, MO, USA).

For primary cortical neuron staining, anti-Tuj1 antibody (Beyotime, Nantong, Jiangsu, China) was used to stain the Neuron-specific class III beta-tubulin, followed by incubation with Rhodamine-conjugated donkey anti-mouse antibodies as secondary antibodies. The nuclei were stained with Hochest 33342 (Sigma, Saint Louis, MO, USA).

RNA interference

The sequence of small interference RNA (siRNA) duplex for dysbindin and p53 are as following: 5’-AAGUGACAAGUCAAGAGAAGCAA-3’ (target to human dysbindin-1 mRNA); 5’-AAGUGAUAAGUCAAGAGAAGCAA-3’ (target to mouse dysbindin-1 mRNA); 5’-AAGCGACAAGUCAAAAGAAGCAA-3’ (target to rat dysbindin-1 mRNA); and 5’-CCACUUGAUGGAGAGUAUU-3’ (target to mouse p53 mRNA). The designed human dysbindin-1 siRNA sequenceswere targeted to nucleotides 175-197 as described elsewhere (3). The siRNA sequences to mouse or rat dysbindin-1 were designed assimilar as the sequences of human by BLAST with human dysbindin-1 mRNA. Mouse p53 siRNA sequences were designed as described elsewhere (4). All double-stranded oligonucleotides were synthesized by Shanghai GenePharma (Shanghai, China). Meanwhile, a non-specific control siRNA (NC) was served as a negative control.

RT-PCR assay

Total RNA was extracted using a protein and RNA extraction kit (Takara, Otsu, Shiga, Japan), and 200 ng RNA from each preparation was reversely transcribed into cDNA for PCR assays using a TransScript First-Strand cDNA Synthesis kit (TransGen, shanghai, china). The following primer pairs were used for amplifying specific genes: 5’-GCGACTGTGATGCGCTAAT-3’ and 5’-GGGCTTCCTCTTGGAGAAG-3’ for human p21; 5’-AGGAGCAAAGTGTGCCGTT-3’ and 5’-GGAGTGATAGAAATCTGTC-3’ for mice p21; 5’-GACCTGACTGACTACCTC-3’ and 5’-GACAGCGAGGCCAGGATG-3’ for human β-actin; 5’-GACCTGACTGACTACCTC-3’ and 5’-GACAGCGAGGCCAGGATG-3’ for mouse β-actin; 5’-GACCTGACAGACTACCTC-3’ and 5’-GACAGTGAGGCCAGGATA-3’ for rat β-actin; 5’-CAGAGCAAATTCCGGCATG-3’ and 5’-GTCAGGGTGCAGGCTGTCC-3’ for human coronin 1b; 5’-GTTGTGCGGCAGAGCAAAT-3’ and 5’-CAAGCTGTCCAGACGGTAC-3’ for mouse coronin 1b; 5’-GTTGTGCGGCAGAGCAAAT-3’ and 5’-GTCAGGGTGCAAGCTGTCT-3’ for rat coronin 1b; 5’-ACGACCACCTCTTCAAGTT-3’ and 5’-AAA GCCTCATCCACATTCA-3’ for human, mouse and rat rab13; 5’-TCTGGGACAGCCAAGTCTG-3’ and 5’-CTTCCAGTGTGATGATGGT-3’ for human and mouse p53; 5’- TCAGGGACAGCCAAGTCTG-3’ and 5’- CTTCCAGCGTGATGATGGT-3’ for rat p53;5’-CTGGTGGACAGCGAGGTG-3’ and 5’-CAGAGTTCAGGAAGACGTC-3’ for human dysbindin-1; 5’-CTGGTGGACAGCGAGGTG-3’ and 5’-CTCGCCTCTCTGCGATCTG-3’ for mouse dysbindin-1; 5’-CTGGTGGACAGCGAGGTG-3’ and 5’-CTCGCCTCTCTGCAATCTG-3’ for rat dysbindin-1; 5’-ATGAAGGACCAGAAGAGGATG-3’ and 5’-GTCCTCAGAGACACTGCTG-3’ for mouse necdin;5’-AAGGACCTGAGCGACCCTAAC and 5’- GAAAACTCTGGCGAGGATGAC for rat necdin, respectively.

Cell culture, transfectionand treatment

HEK293, Neuro2a (N2a), HCT116 wild-type (WT) (p53+/+), HCT116 p53-null cells (p53-/-) and SH-SY-5Y cells were all cultured in Dulbecco’s modified Eagle’s medium (DMEM) (GIBCO, Los Angeles, CA, USA) containing 10% fetal bovine serum (FBS) (GIBCO, Los Angeles, CA, USA).

For transfection, cultured cells were washed with Opti-DMEM and then transfected with suitable plasmids or siRNA using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) in DMEM without serum. For a high efficiency of transfection in HCT116 p53 WT or HCT116 p53 KO cells, Opti-MEM medium without serum was used instead of DMEM. DMEM containing 10% FBS was added into the culture medium six hours after transfection. Forty-eight hours after transfection, cells were observed using an inverted system microscope IX71 (Olympus, Tokyo, Japan), or subjected to immunoblot analyses or immunoprecipitation assays or luciferase assays.

For doxorubicin (Sigma, Saint Louis, MO, USA) treatment, cells were treated with doxorubicin at a final concentration of 2 μmol/L 12 hours after transfection. After incubation, cell lysate were subjected to immunoblot analyses.

For retinoic acid (Sigma, Saint Louis, MO, USA) treatment, cells 24 hours after transfection were treated with 2% FBS in DMEM containing retinoic acid at a final concentration of 20 μmol/ml. After incubation, mRNA was prepared from cells for RT-PCR analyses.

Dual-Luciferase reporter gene assay

HCT116 WT or HCT116 p53-null cells were seeded onto 12-well plates (5×105 cells per well) and cultured for 24 hours in DMEM contained 10% FBS before transfection. Cells were transfected with p53-dependent reporter plasmids (A kind gift from Dr. Ratna Ray,Department of Pathology,Saint LouisUniversity) encoding 13 copies of the p53 response element driving a firefly luciferase (pG(13)Py/Luc) into HCT116 WT or p53-null cells using Lipofectamine 2000. In each transfection, cells were also co-transfected with Renillaluciferase reporter plasmids(Promega, Madison, WI, USA). Thirty-six hours after transfection, firefly and Renillaluciferase activity were measured with Dual-Luciferase Reporter Assay System using Veritas Microplate luminometer according to manufacturer's instructions (Promega, Madison, WI, USA). The absolute values of firefly luminescence were normalized to those of Renillaand the ratios were presented as mean ± SE with three transfection experiments.

MTT assay

Cell viability was determined using the mitochondrial dependent conversion of the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) (Sigma, Saint Louis, MO, USA). N2a cells were treated with DMEM containing low serum or normal serum for 24 hours after transfection. The culture medium was then refreshed by MEM without phenol red and then MTT was added to a working concentration of 0.5 mg/mL. After an incubation for three hours at 37°C.The medium was carefully aspirated, and 100 μl of dimethyl sulfoxide was added to dissolve the coloredformazan products. Absorbance wasdetermined at 570 nm ona scanning multi-well plate reader (Bio-Rad) after agitatingthe plates for 15 min on a shaker.

Reference

1.Fan J, Ren H, Jia N, Fei E, Zhou T, Jiang P et al.DJ-1 decreases Bax expression through repressing p53 transcriptional activity. J Biol Chem 2008 Feb 15; 283(7): 4022-4030.

2.Fei E, Ma X, Zhu C, Xue T, Yan J, Xu Y et al.Nucleocytoplasmic shuttling of dysbindin-1, a schizophrenia-related protein, regulates synapsin I expression. J Biol Chem 2010 Dec 3; 285(49): 38630-38640.

3.Kubota K, Kumamoto N, Matsuzaki S, Hashimoto R, Hattori T, Okuda H et al. Dysbindin engages in c-Jun N-terminal kinase activity and cytoskeletal organization. Biochem Biophys Res Commun 2009 Feb 6; 379(2): 191-195.

4.Hasegawa K, Yoshikawa K. Necdin regulates p53 acetylation via Sirtuin1 to modulate DNA damage response in cortical neurons. J Neurosci 2008 Aug 27; 28(35): 8772-8784.

Supplementary figure legends

Figure S1 Dysbindin-1 interacts with necdin.(A)GST pulldown assayswere performed, showing that GST-dysbindin-1 directly interacts with His-necdin (His-Ndn). (B) Immunoprecipitation assayswere performed, showing that FLAG-dysbindin-1 interacts with Ndn-EGFP in HEK293A cells.

Figure S2 Regulation of p53 target gene products by dysbindin-1.(A) Immunoblot analyses were performed, showing thatdysbindin-1-EGFP increases p21 protein levels in HCT116 p53 WT cells. Densitometric analyses from three independent experiments were quantified by one-way ANOVA, *p<0.05. The intensity of the bandsof p21 was normalized to those of GAPDH. (B) RT-PCR assayswere performed, showing thatdysbindin-1-EGFP increases p21 mRNA levels in HCT116 p53 WT cells. Densitometric analyses from three independent experiments were quantified by one-way ANOVA, *p<0.05. The intensity of the bands for p21 was normalized to the β-actin. (C) Immunoblot analyses were performed, showing that knockdown of dysbindin-1 in HCT116 p53 WT cells with small interference RNA (siRNA) causes the decreases of p21 protein levels compared with control siRNA (si-NC). Densitometric analyses from three independent experiments were quantified by one-way ANOVA, *p<0.05. (D) Immunoblot analyses and RT-PCR assays were performedusing HCT116 p53-null cells transfected with expression plasmids as indicated, showing that HA-dysbindin-1 blocks the necdin-mediated downregulation of the p21 protein or mRNA levels.

Figure S3 No influence of dysbindin-1 on the p53 and necdin expression level. (A) RT-PCR assays were performed, showing that knockdown of dysbindin-1 decreases the Coronin 1b, Rab13, p21 mRNA levels, but no affects p53 and necdin mRNA levels in N2a cells. Densitometric analyses from three independent experiments were quantified by one-way ANOVA, *p<0.05, NS: not significant. (B) RT-PCR assays were performed, showing that knockdown dysbindin-1 does not influence the p53 and necdin mRNA levels in primary cultured rat cortical neurons. Densitometric data analyses from three independent experiments were quantified by one-way ANOVA, NS: not significant. (C) RT-PCR assays were performed, showing no alterations of p53 and necdin mRNA levels in sandy mice compared with wile-type mice. Densitometric data analyses from three independent experiments were quantified by one-way ANOVA, NS: not significant.

Figure S4Neuron soma size analysis showed no significant alterations of cultured cortical neurons from sandy mice. The bar graphs show relative average soma areasabout 300 neurons of wide type or sandy mice from three independent experiments (NS: not significant, p=0.162, one-way ANOVA).

Figure S5 Cell viability assay.N2a cells transfected with EGFP or EGFP-p53 were treated with normal serum (10% FBS in DMEM) or low serum (2% FBS in DMEM) for 24 hours. Cell viability was then determined using MTT assays. The bar graphs show that no significance between cells transfected with EGFP or EGFP-p53 in the normal or differentiation conditions. Quantitative data from three independent experiments were quantified by one-way ANOVA,NS: not significant (viability of cells transfected with EGFP in normal serum is 100%).

1