Supplementary Materials for: “The Clathrin-Binding Domain of CALM-AF10 Alters the Phenotype of Myeloid Neoplasms in Mice.” by Stoddart et. al.
Supplementary Methods
FRET Analysis.
Acceptor FRET imaging experiments were performed on a Leica SP2 confocal microscope (Leica Microsystems). The acceptor photobleaching module of the Leica software was used for the acceptor photobleaching FRET assay. The 405-nm laser line was used to excite CFP and the 514-nm laser line was used to excite and bleach YFP. A region containing aggregates that expressed both CALM2091AF10-CFP and CALM2091AF10-YFP with similar levels of expression was selected for bleaching. The Leica confocal software was configured to achieve a 50% bleach of YFP. Within bleached regions, regions of interest (ROI) were drawn around CALM2091AF10 aggregates. FRET efficiency was calculated as follows: FRETeff = (Dpost − Dpre)/Dpost for all Dpost > Dpre, where Dpre and Dpost represent donor fluorescence intensity before and after photobleaching, respectively. The average FRET efficiency of unbleached ROIs (3.5%) served as a negative control. Within bleached zones, only FRET efficiencies > 3.5% were considered positive. At least 8 different cells were examined for the presence of FRET signals in each experiment, and a total of 147 and 97 ROIs within bleached and non-bleached areas, respectively, were used to calculate average percent FRET and average FRET efficiencies. For donor FRET, the CFP excitation wavelength on the Olympus IX 70 microscope was used for bleaching and images, with a time-lapse interval set at 3 frames, was captured using the Metamorph software. ROIs were selected and the resulting decay curves were fitted to the equation for a single exponential decay with offset using Image J. Fluorescence intensity (y)=a-bx + c, where “a” denotes the starting value, “c” (offset) denotes the final fluorescence signal, “b” is the decay constant and “x” denotes a relative value defined by iterations of bleaching procedures. A smaller decay constant, compared to CFP alone control, represents slower decay and indicates that FRET has occurred.
Preparation of Clathrin-coated vesicles.
Clathrin-coated vesicles were isolated by a differential centrifugation method adapted from Chakrabarti, et al (J Cell Biol. 1993;123:79-87). Briefly, cells were homogenized by three freeze-thaws in a 100mM 2-N-morpholino ethanesulfonic acid (MES) buffer with 1mM EGTA, 0.5mM MgCl2, 0.02%NaN3, 50mM NaF, 1mM Phenanthroline, 10 µg/ml pepstatin, aprotinin, and leupeptin, pH 6.5. After removal of cellular debris, crude membrane structures were isolated by centrifugation (100,000 g). The crude membrane pellet was resuspended in an equal volume of a ficoll/sucrose solution (12.5% wt/vol), centrifuged at 28,000g to pellet aggregated membrane and cytoskeleton components, and the supernatant diluted with five volumes of MES buffer and centrifuged at 100,000g to obtain a pellet of ~80% pure coated vesicles.
Transferrin Uptake
To monitor transferrin uptake by flow cytometry, CA cell lines were incubated with 10 g/ml Alexa Fluor 647 conjuated-transferrin for 15 minutes to allow binding and then incubated at 37C for 0-30 minutes to allow internalization. Transferrin remaining on the cell surface was removed by a mild acid wash (0.2M acetic acid, 0.5M NaCl) and the intensity of the Alexa Fluor 647 fluorophore was measured to monitor internalization of transferrin. To monitor transferrin uptake by immunofluorescence, 293T cells were transiently transfected with CALM-AF10-GFP or control constructs. Twenty-four hours later, cells were grown on coverslips overnight, then incubated with 10 g/ml Texas Red conjuated-transferrin for 15 min at 37 C, washed in PBS and mounted for microscopy. Transferrin uptake in GFP+ cells was monitored by immunofluorescence.
Microarray analysis
We used Stat60 (Tel-Test) to isolate RNA from GFP+ sorted spleen cells isolated from mice with AML or MPD that were transplanted with cells expressing CALM2091AF10 or CALM1926AF10, respectively. RNA was purified with the RNeasy Mini Kit (Qiagen), and hybridized to standard Affymetrix 430 2.0 mouse genome arrays. Raw data were normalized with the RMA algorithm implemented in the “Expression File Creator” module from the Gene Pattern Software Package ( The Comparative Marker Selection module was used to identify differentially expressed genes between the two groups. For each gene, the Comparative Marker Selection module uses a test statistic to calculate the difference in gene expression between the two classes, estimates the significance (P-value) of the test statistic score, and then sorts the genes based on the value of their test statistic scores. A derived dataset of the highest scoring 200 genes (referred to as RANK) was created and viewed using the Heat Map Viewer. Analysis of differentially expressed genes, with a P value <0.05, identified 112 probe sets, corresponding to 87 genes that were significantly under-expressed in CALM2091AF10+ AMLs compared to CALM1926AF10+ MPDs, whereas only 31 probe sets, corresponding to 28 genes, were significantly over-expressed in AML samples.
Transfection of small interfering RNA (siRNA).
To knock-down CALM-AF10 (human sequence), siRNA target sequences specific for human AF10 were used, as they did not cross-react with mouse AF10. Two clathrin heavy chain (CLTC) pools were: siGenome SMARTpool M-063954-01-0005 specific for mouse CLTC and siGenome SMARTpool M-004001-00-0005 designed for human CLTC, but cross-reactive with mouse. The siGenome non-targeting siRNA #2 was used as a control. All siRNAs were purchased from Thermo Scientific.
AF10-1st: AGGUAAUGGUGCCGAUAAUUU
AF10-2nd: AGAUAAUGCAAGUCAGAAA
D-0636954-01, mouse CLTC: CAACUUAGCUGGUGCUGAA
D-0636954-02, mouse CLTC: UAGAGGAGCUUAUCAACUA
D-0636954-03, mouse CLTC: UCACAGAGCUAGCUAUUUU
D-0636954-04, mouse CLTC: GAUCAUCAAUUACCGUACA
D-004001-01, ‘human’ CLTC: GAAAGAAAUCUGUAGAGAAA
D-004001-02, ‘human’ CLTC: GCAAUGAGCUGUUUGAAGA
D-004001-03, ‘human’ CLTC: UGACAAAGGUGGAUAAAUU
D-004001-04, ‘human’ CLTC: GGAAAUGGAUCUCUUUGAA
Non-targeting siRNA #2: GGAUCUGGCCAGCUUUGAU
Supplementary Figure Legends
Figure S1. CALM2091AF10 co-localizes with clathrin in the cytoplasm, but not in the nucleus in 293T cells.
293T cells were transiently transfected with expression constructs of CALM-AF10 fused to GFP. Cells were left untreated or treated with 20 nM leptomycin B to block nuclear export, where indicated. Expressed fusion proteins were detected by GFP fluorescence, nuclei were visualized by DAPI staining, and clathrin was detected by immuno-staining with the monoclonal anti-clathrin antibody, X22, followed by rhodamine-red conjugated donkey anti-mouse IgG. Original magnification 787.5 for all panels.
Figure S2. Variable expression of CALM-AF10 in leukemic mice, regardless of CALM breakpoint. RNA was isolated from CALM-AF10+ Ba/F3 cells or CALM-AF10+ spleen cells from leukemic mice (CALM2091AF10 mice n=4; CALM1926AF10 mice n=3). CALM-AF10+ expression levels were quantified by real-time PCR, using forward primers that spanned the CALM2091AF10 or CALM1926AF10 breakpoints with a reverse primer in exon 6 of AF10. Expression levels were calculated from standard curves with known amounts of CALM2091AF10 or CALM1926AF10 plasmid DNA and normalized to Gapdh expression. Error bars represent experimental triplicates for each sample. Relative quantification reveals that neither CALM-AF10 fusion construct was expressed at consistently higher levels.
Figure S3. Analysis of gene expression of immediate target genes following CALM-AF10 expression. E 14.5 day fetal liver progenitors isolated from C57Bl/6 mice were infected with retroviral vectors expressing either CALM2091AF10 or CALM1926AF10. Cells were sorted for GFP-positivity, and grown in IL-3, IL-6, and SCF in vitro for a total of 10-12 days post initial infection. RNA was isolated, cDNA was generated and real-time PCR was performed by standard methods. (A) Expression of CALM2091AF10 or CALM1926AF10 was confirmed in four independent experiments. (B) Relative gene expression after enforced expression of CALM-AF10 fusions or MIGR1 is shown. CALM-AF10 expression resulted in changes in the expression of genes associated with myeloid differentiation (Csf1r, Itgam, Kit) relative to MIGR1 controls. Other changes originally observed in MPD vs. AML cells (e.g., Klf9, Pim1, Crebbp) were not observed in progenitor cells expressing CALM-AF10 for a short, defined period suggesting, that events secondary to CALM-AF10 expression caused these changes.
Figure S4. Histological analysis of CALM-AF10+ cell lines. To generate cell lines, GFP+ cells were sorted from the spleen of mice with AML or MPD, and plated in methylcellulose with IL-3, IL-6 and SCF. Ten days later, individual colonies were selected and grown in liquid cultures containing IL-3. Wright-Giemsa staining of cytospins is shown. These cells displayed an immature myeloid phenotype; however, some mature neutrophils were observed for the lines CA2091-CL2 and CA1926-CL1.
Figure S5. CALM2091AF10 localizes to nucleus of interphase cells and co-localizes with clathrin in metaphase cells in a CALM-AF10+ leukemia cell line. (A) Immunofluorescence images of CA2091-CL1 cells were stained with an anti-FLAG antibody and DAPI and captured in different planes. CALM2091AF10 aggregates localize throughout the volume of the nucleus, and can only be found infrequently in the cytoplasm, as shown by the white arrow[FN1]. The anti-CALM antibody detects punctate CALM2091AF10 in the nucleus as well as endogenous CALM at the plasma membrane. (B) Co-staining of CALM2091AF10 (flag antibody) and clathrin (clathrin heavy chain antibody) in representative interphase and metaphase CA2091-CL1 cells. CALM2091AF10 and clathrin co-localize only in metaphase cells.
[FN1]Was this done using confocal microscopy. If so, we should indicate this.