Supplementary materials for Nemoto et al.
Base-changes identified outside of 18S rRNA in the Ts- or Slg- rdn mutants
The mutation sites identified in the ten 18S rRNA mutant alleles are listed in Table S2. In addition to point mutations in the18S rRNA-coding region, each mutant plasmid contained one to three mutations mapping outside of it (Table S2). These additional mutations were judged to be silent for the following reasons.
(i) Mutations in the PolI promoter area: DG175 (in rdn-42) and G188A (in rdn-61) map in the PolI promoter region, but these did not affect the production of the ribosome, as the strains bearing the mutations produced a normal yield of RNA and displayed a normal ribosome abundance (per A260 unit) (except less 40S, see text and Fig. 5B, panel 1). These mutations map between core promoter elements I (nt. +8 to -28) and II (-51 and -70); linker mutations altering several bases near these mutation sites reduced the promoter strength by only 40%, while those altering the neighboring core elements reduced it by >~90% (1). The region between the elements I and II, which contains DG175 and G188A, are degenerate in closely related Saccharomyces species (S. sensu stricto); only 6 out of 20 bp are conserved (2). A similar natural variation, C191A, was found in a strain of S. cerevisiae (see below Table S3).
(ii) G542A (in rdn-41) in 5` external transcribed sequence (ETS) did not affect production or processing of the ribosome, except for the reduced 40S abundance due to the 18S rRNA mutation.
(iii) DT2762 and DT3334, found twice independently in four 18S rdn mutants, are one-base deletion within 12 and 10-bp-long T stretches, respectively, located in the intercistronic spacer regions of the 35S rRNA-coding area. These are common DNA replication errors and found in the majority of >100 sequenced spacer sequences from S. cerevisiae and closely related species (3) (Table S5).
(iv) Mutations in 25S rRNA: rdn-41 and rdn-59 contained a single base-substitution, C4366 T (rdn-41b) or G3953A (rdn-59b), respectively, in the 25S rRNA-coding region, in addition to the 18S rRNA mutation. G3953A (rdn-59b) maps in Eukarya-specific expansion segment, ES7, whose functional significance has not been verified. Thus, the effect of G3953A on ribosome function is least likely. However, C4366 T (rdn-41b) changes a site of relatively high conservation (category 1 as in the viability map of Fig. S2). Therefore, the exclusion of C4366T from the mutation causing the type I phenotype of the rdn-41 allele is based on experimental evidence, as indicated in the text (Fig. S3 and Fig. 2).
(v) All other mutations, DT7110, WT7110, DT7386, DT7749, WT7749, T7854C, DA7942, WA7942, and WA9124 are located downstream of the 3`-end of 35S rRNA, and therefore, would not likely affect the production or maturation of the ribosome. In addition, all of them except T7854C are a base deletion or insertion within long stretches of the same nucleotide (A or T), which can be introduced readily as DNA replication errors. As described in Table S5, variations in the length of these A or T stretches are found to occur naturally in different clones of S. cerevisiae or closely related species. As for T7854C (in rdn-71), the mutation site is located ~100-bp downstream of the 5S-coding region and maps in the 67-bp-long rCNS1, one of the 17 elements with similar sizes conserved in the intergenic spacer (IGS) regions of S. cerevsiae and its close relatives’ RDN repeat (2). The biological significance of the role of rCNS1 has not been reported, nor is it assumed for regulating the production of rRNAs.
In conclusion, all the mutations in the ITS and NTS regions (categorized as iii and v) are frequently observed polymorphisms at A/T stretches. The mutations in ETS1 (categories i and ii) do not map in the promoter elements and we also showed that they do not affect the abundance of the ribosome (except for reduced 40S abundance that is observed with all the rdn mutations). Finally, we showed by experiments that the 25S mutations found in rdn-41 and rdn-59 (category iv) do not contribute to the phenotypes observed with these alleles.
References
1. Musters, W., Knol, J., Mass, P., Dekker, A. F., van Heerikhuizen, H., and Planta, R. J. (1989) Nucl Acids Res 17, 9661-9678
2. Ganley, A. R. D., Hayashi, K., Horiuchi, T., and Kobayashi, T. (2005) Proc Natl Acad Sci USA 102, 11787-11792
3. Montrocher, R., Verner, M. C., Briolay, J., Gautier, C., and Marmeisse, R. (1998) Int J Syst Bacteriol 48, 295-303
4. Yamamoto, Y., Singh, C. R., Marintchev, A., Hall, N. S., Hannig, E. M., Wagner, G., and Asano, K. (2005) Proc Natl Acad Sci USA 102, 16164-16169
Legends to supplementary figures
Fig. S1. Primary structure of the RDN insert of pNOY373 and locations of oligos used in this study. Schematics at the center describe the structure of the 9150-bp RDN insert of pNOY373. Thin horizontal line indicates the entire length of the RDN insert whereas thick lines denote the flanking vector sequences. Boxes indicate rRNA coding regions. Hooked arrows indicate the start and stop sites of Pol I transcription producing the 35S rRNA and the start stie of Pol III transcription producing 5S rRNA. Hooked vertical lines locate the rdn mutation sites, with the alleles numbers italicized. Horizontal arrowheads (with barbed ends indicating 5` end) describe the locations of primers used in this study (Table S1). They are grouped into squares by the purpose of the experiments. Positions are located with nucleotide numbers starting from the PstI site (nt. 1-6) at the end of the insert.
Fig. S2. Locations of 18S rdn mutations (in red) and polymorphisms found in the S. cerevisiae 18S rRNA (in black) within the 18S rRNA variability map (http://bioinformatics.psb.ugent.be/webtools/rRNA/). Polymorphisms are as listed in Table S4. Lines indicate base changes. Arrows indicate insertion or deletion. Base insertions are shown by pointed ends, located between rRNA bases. Base deletions are represented by the deleted bases at the barbed end.
Fig. S3. Phenotypes of yeast carrying rdn-41a (A952C) and rdn-59a (A333G). (A) Polysome profile and 60S/40S abundance test were performed using strains KAY906 (rdn-41a, row 3) and KAY907 (rdn-59a, row 6), as described under Materials and methods, and presented as in Fig. 2. (B) and (C) Ts- and Gcn- phenotype tests. Cultures of KAY761 (RDN+, rows 1 and 4), KAY757 (rdn-41, row 2), KAY906 (rdn-41a, row 3), KAY575 (rdn-59, row 5), and KAY907 (rdn-59a, row 6) were diluted and spotted onto YPD agar plates and incubated for 2 days at indicated temperatures in (B). In (C), the same cell culture was spotted onto SC-his agar plates supplemented with 40 mM leucine and with (+) or without (-) 50 mM 3AT. The plates were incubated at 34o C for 3 days and photographed.
Fig. S4. Sequence analysis of cDNAs derived from mutant 40S subunits. (A) EtBr-staining of RT-PCR products from rdn mutant ribosomes. Pairs of oligos indicated across the top were used to perform RT-PCR (lanes labeled “+”). PCR was also performed without RT (lanes labeled “-“). (B) A portion of the cDNA shown in (A) was sequenced using the oligo listed to the left in (A). Chromatograms at the mutation sites are shown with the boxes highlighting the mutated residues. The wild-type base is indicated with its location within 18S rRNA as well as within the pNOY373 insert (DQ888227, number in parenthesis).
Fig. S5. Analysis of rRNA intermediate species. (A) Schematics illustrating different rRNA intermediates (horizontal lines). The primary transcript 35S rRNA is depicted on top, with vertical arrows indicating the location of cleavage sites and thick horizontal lines indicating the area of final rRNA products. Cleavage sites only relevant to this study are shown. Parenthesis indicates the formation of an aberrant 23S species from 35S rRNA. Gray bars below each transcript indicate the location of the probe used in (B) to detect them. (B) RNA analysis. ~5 mg of RNA isolated from 1.2- 1.3 A600 units of exponentially-growing NOY908 (W) or rdn mutant (numbers indicating originally numbered rdn alleles) yeast culture prepared at 30o C in YPD was analyzed by agarose gel electrophoresis in the presence of EtBr (panel 1), followed by Northern blotting with 32P-labeled probe specific to the region between sites D and A2 (panel 2; see Materials and methods). Arrows indicate the location of different rRNA species. Panel 3, the graph indicating the abundance of 20S rRNA detected in panel 2, relative to that of 20S rRNA found in wild-type yeast in lane 1. Bars indicate SD (n=2).
Table S1. Oligodeoxyribonucleotides used in this study
RDNA1
RDNA1.1
RDNA2
RDNA3
RDNA4
RDNA5
RDNA6
RDNA7
RDNA8
RDNA9
RDNA10
RDNA11
RDNA12
RDNA13
RDNA1.6
18S rRNA-R
RDNA1.8-R
20S-F
20S-R
UFWb
URVb / caagtgtaacctcctctcaa
ctcaataagtatcttctagc
atgtaaataccttaacgagg
ggagtatggtcgcaaggc
aaagtcgtaacaaggtttcc
gtgaattgcagaattccgtg
gatagcgaacaagtacagtg
cgtatcagttttatgaggta
tcttcacggtaacgtaactg
ctatgactctcttaaggtag
gataactggcttgtggcagt
cttgttgttacgatctgctg
gccagtgcaatatatacatg
cagttgatcggacgggaaac
atcctgccagtagtcatat
taatgatccttccgcaggttcac
tacgcctgctttgaacact
gccgggcctgcgcttaa
cggttttaattgtcctataa
caggaaacagctatgaccatgattacgcc
ccagggttttcccagtcacgacg / 601-620
822-841
1444-1463
2034-2051
2677-2696
3157-3176
3821-3840
4457-4476
5107-5126
5737-5756
6296-6315
6830-6849
7492-7511
8022-8041
934-952
2723-2701
1703-1685
2821-2837
2928-2909 / For sequencing
For sequencing
For sequencing
For sequencing
For sequencing
For sequencing
For sequencing
For sequencing
For sequencing
For sequencing
For sequencing
For sequencing
For sequencing
For sequencing
For RT-PCR
For RT-PCR
For RT-PCR
For 20S rRNA
For 20S rRNA
For sequencing
For sequencing
aNumbered as in the pNOY373 RDN insert (DQ888227)
bUniversal primers used in (4)
Table S2. Mutations found in the rDNA inserts of rdn alleles altering 18S rRNA*
41 / G542A / A1875C / C4366 T / DA7942
41a / G542A / A1875C
42 / DG175 / A2116T / WA9124
44 / G1798A / DT2762 / DT7110
59 / A1256G / G3953A / WT7749
59a / A1256G
60 / A1061G / DT3334 / DT7386
61 / G188A / G1245A / WA7942
63 / WG2035 / WA7942
71 / G1285A / WT7110 T7854C DA7942
72 / G1845A / DT3334 / DT7749
76 / G2031A / DT2762 / DA7942
*W and D, insertion after and deletion of the nucleotide indicated.
# Nucleotide number in the pNOY373 insert sequence as deposited in Genbank (accession number DQ888227).
Table S3. Polymorphisms found within the sequence 5` of 18S rRNA (nt 1-923 of pNOY373 insert)*
94 G to A 1/14 DQ130093
191 C to A 1/14 AJ243217
402 A to G 2/8 X00731 X87401
427 C to T 2/8 X00731 X87401
474 W(CA) 1/7 M87349
514 W G 1/6 M87349
579 DC 1/8 M87368
591 DT 4/6 X00731 X87401 J01354 M35588
601 C to G 1/6 M35588
652 DA 2/6 J01354 M35588
724 C to T 1/6 X87401
737 T to C 2/6 J01354 M35588
742,743 DAA 1/6 M35588
750 DT 1/6 X87401
783 T to C 2/6 X87401 M35588
804 WC 1/5 X87401
869 DA 1/5 M87368
*Total of 18 Saccharomyces cerevisiae (Sce) and 1 S. pastrianus (Spa, X00731) sequences hit with e-value < 1e-1, hit length > 300bp, and identities > 95%.
a W and D, insertion after and deletion of the nucleotide indicated.
b number of polymorphism vs. number of sequences carrying the same nucleotide at the relevant position as found in pNOY373,
Table S4. Polymorphisms found within the 18S rRNA coding region (nt 924-2723)*
Nt. # / 18S Nt# / Mutationa / Frequencyb / Genbank acc. # with polymorphisms987 / 64 / W G / 2/20 / AY218889, AY218890
991 / 68 / W T / 1/20 / AY218891
1005 / 82 / T to C / 1/21 / AY790535
1073 / 150 / T to C / 2/22 / J01353, V01335
1158 / 235 / G to C / 1/22 / V01335
1277 / 354 / W C / 1/22 / AY790536
1496 / 573 / W C / 2/23 / AY251631, AY251636
1515 / 592 / D A / 1/23 / AY790536
1519 / 596 / W C / 1/23 / AY218892
1544 / 621 / W A / 1/23 / AY799853
1610 / 687 / G to A / 2/24 / AY497740, AY790536
1660 / 737 / G to A / 21/24 / Z73326, J01353, V01335, AY251629, AY251631, AY251623, AY251630, AY251634, YSCL9634, AY218888, AY218889, AY218890, U53879, Z75578, AY218891, AY218892, AY799853, AB182326, AY251636, AY497740, AY790536
1684 / 761 / G to A / 1/24 / AY251634
1725 / 802 / W G / 1/24 / AY251634
1759 / 836 / T to G / 1/24 / AY251634
1770 / 847 / A to C / 2/24 / AY218889, AY218890
1802 / 879 / W G / 2/24 / AY218889, AY218890
1804 / 881 / W C / 2/24 / AY218889, AY218890
1807 / 884 / A to G / 3/24 / J01353, V01335, AY251631
1821 / 898 / D A / 2/24 / J01353, V01335
1822 / 899 / G to A / 1/24 / AY251634
1870 / 947 / T to C / 2/24 / AY218889, AY218890
1890 / 967 / W C / 2/24 / AY218889, AY218890
1924 / 1001 / A to T / 2/24 / J01353, V01335
1926 / 1003 / A to G / 2/24 / J01353, V01335
1943 / 1020 / A to C / 1/24 / AY251634
1946 / 1023 / ATA to CAT / 2/24 / AY218889, AY218890
1964,5 / 1040,41 / D GG / 2/24 / J01353, V01335
1983 / 1060 / W T / 1/24 / AY790535
1991 / 1068 / W C / 1/24 / AY790535
1995 / 1072 / C to T,G / 3/24 / AY218888, AY218889, AY218890
1998 / 1075 / C to T / 2/24 / J01353, V01335
2011 / 1088 / W A / 1/24 / AY790535
2018 / 1095 / T to G / 1/24 / AY218888
2048 / 1125 / W A / 1/24 / U02969
2085 / 1162 / C to T / 2/24 / J01353, V01335
2102 / 1179 / W G / 1/24 / AY251629
2105 / 1182 / D T / 2/24 / J01353, V01335
2136 / 1213 / D G / 1/24 / AY790536
2144 / 1221 / D A / 1/24 / AY497740
2206 / 1283 / W T / 2/23 / J01353, V01335
2209 / 1286 / T to C / 2/23 / J01353, V01335
2334 / 1411 / W A / 1/23 / AB182326
2369 / 1446 / W A / 2/23 / J01353, V01335
2374 / 1451 / C to T / 4/23 / AY251629, AY251631, AY251630, AY251636
2364 / 1441? / C to T / 2/23 / AY251623, AY25163
2378 / 1455 / W G / 1/23 / AY251630
2378 / 1455 / G to C / 1/23 / AY790536
2390 / 1467 / C to G,T / 2/23 / AY251629, AY251636
2488 / 1565 / C to T / 1/21 / AY251629
2558 / 1635 / A to C / 1/21 / AY251629
2622 / 1699 / W G / 1/21 / AY251636
2632 / 1709 / C to T / 1/21 / AY251629
2649 / 1726 / G to A / 1/21 / AY790536
2650 / 1727 / D G / 2/21 / AY790536, AY790535
2666 / 1743 / D T / 1/21 / AY790536
2682 / 1759 / C to T / 2/21 / AY251629, AY251631
*Total of 24 Saccharomyces cerevisiae (Sce) sequences hit with e-value < 1e-1, hit length > 300 bp, and identities > 95%.