Supplementary material 1. Detail of the microsatellite markers used.

Locus / Primer / Colour / Author / GenBank accession number
Ssa85 / F: AGGTGGGTCCTCCAAGCTAC / HEX (Green) / (O’Reilly et al., 1996) / U43692.1
R: ACCCGCTCCTCACTTAATC
Ssa171 / F: TTATTATCCAAAGGGGTCAAAA / NED (Yellow) / (O’Reilly et al., 1996) / U43693.1
R: GAGGTCGCTGGGGTTTACTAT
Ssa197 / F: GGGTTGAGTAGGGAGGCTTG / VIC (Green) / (O’Reilly et al., 1996) / U43694.1
R: TGGCAGGGATTTGACATAAC
SsaD58 / F: TAGAGTTTGTTCTCTGGCTTTG / HEX (Green) / (King et al., 2005) / AF525210.1
R: AGACCCTAGGACTGGCTACTG
SsaD71 / F: AACGTGAAACATAAATCGATGG / PET (Red) / (King et al., 2005) / AF525211.1
R: TAAGAATGGGTTGCCTATGAG
SsaD144 / F: TTGTGAAGGGGCTGACTAAC / FAM (Blue) / (King et al., 2005) / AF525203.1
R: TCAATTGTTGGGTGCACATAG
SsaD486 / F: TCGCTGTGTATCAGTATTTTGG / FAM (Blue) / (King et al., 2005) / AF525208.1
R: ACTCGGATAACACTCACAGGTC
Ssosl417 / F: TTGTTCAGTGTATATGTGTCCCAT / FAM (Blue) / (Slettan et al., 1995) / Z48598.1
R: GATCTTCACTGCCACCTTATGACC
SsspG7 / F: CTTGGTCCCGTTCTTACGACAACC / NED (Yellow) / (Paterson et al., 2004) / AY081813.2
R: TGCACGCTGCTTGGTCCTTG
Sssp1605 / F: CGCAATGGAAGTCAGTGGACTGG / NED (Yellow) / (Paterson et al., 2004) / AY081812.1
R: CTGATTTAGCTTTTTAGTGCCCAATGC
Sssp2215 / F: ACTAGCCAGGTGTCCTGCCGGTC / NED (Yellow) / (Paterson et al., 2004) / AY081810.1
R: AGGGTCAGTCAGTCACACCATGCAC
Sssp2216 / F: GGCCCAGACAGATAAACAAACACGC / VIC (Green) / (Paterson et al., 2004) / AY081811.1
R: GCCAACAGCAGCATCTACACCCAG
MST-3 / F: CCCTGGTTTGACTTTGTCTCA / HEX (Green) / (Presa Guyomard, 1996) / AB001060.1
R: AGGCACTCTCACCAGCTAAAGATG
Alu5 / F: TATGTGATTAGGGCTTGC / FAM (Blue) / (Salmon Genome Project Resources) / AF271471.1
R: CTTGGCGTAGTTTAGTGC
Bx311224 / F: CCGTGTGAAACCTGCATCC / NED (Yellow) / (Salmon Genome Project Resources) / BX311224.3
R: CCTTGGAATGCTTACCCTACC

O’Reilly PT, Hamilton LC, McConnell SK & Wright JM (1996) Rapid analysis of genetic variation in Atlantic salmon (Salmo salar) by PCR multiplexing of dinucleotide and tetranucleotide microsatellites. Canadian Journal of Fisheries and Aquatic Sciences 53:2292–2298.

King TL, Eackles MS, Letcher BH (2005) Microsatellite DNA markers for the study of Atlantic salmon (Salmo salar) kinship, population structure, and mixed-fishery analyses. Molecular Ecology Notes 5:130-132.

Slettan A, Olsaker I, Lie Ø (1995) Atlantic salmon, Salmo salar, microsatellites at the SSOSL25, SSOSL85, SSOSL311, SSOSL417 loci. Animal Genetics, 26, 277–285.

Paterson S, Piertney SB, Knox D, Gilbey J & Verspoor E (2004) Characterisation and PCR multiplexing of novel highly variable tetranucleotide Atlantic salmon (Salmo salar) microsatellites. Molecular Ecology Notes 4:160–162.

Presa P & Guyomard R (1996) Conservation of microsatellites in three species of salmonids. Journal of Fish Biology 49:1326-1329.

Supplementary material 2. Stocking (expected ratio of hatchery-origin adults), Nc, Fis, Fst intra-river and inter-river at the 15 microsatellite markers used, for the 9 rivers and the 3 years and on average for the three years. Color gradient correspond to Fst values gradient (Dark blue for smallest values to dark red for highest values).

2010
RIVER / Stocking / Nc / Fis / Fst intra / GOD / GPA / MAL / MAT / PCA / ROC / SJE / SMA
GOD / 0.06 / 842 / 0.02 / 0.008 / Fst inter
GPA / 0.01 / 284 / 0.02 / 0.008 / 0.054
MAL / 0.25 / 590 / 0.01 / 0.000 / 0.044 / 0.052
MAT / 0.00 / 1498 / 0.02 / 0.002 / 0.031 / 0.024 / 0.036
PCA / 0.00 / 338 / 0.01 / 0.000 / 0.029 / 0.024 / 0.035 / 0.005
ROC / 0.04 / 1069 / 0.00 / 0.008 / 0.017 / 0.041 / 0.026 / 0.018 / 0.021
SJE / 0.00 / 917 / 0.02 / 0.011 / 0.037 / 0.016 / 0.049 / 0.009 / 0.011 / 0.026
SMA / 0.10 / 744 / 0.00 / 0.007 / 0.043 / 0.043 / 0.011 / 0.029 / 0.030 / 0.024 / 0.037
TRI / 0.00 / 763 / 0.01 / 0.000 / 0.021 / 0.041 / 0.034 / 0.022 / 0.025 / 0.013 / 0.030 / 0.030
2009
RIVER / Stocking / Nc / Fis / Fst intra / GOD / GPA / MAL / MAT / PCA / ROC / SJE / SMA
GOD / 0.02 / 767 / 0.01 / 0.008 / Fst inter
GPA / 0.10 / 103 / -0.01 / 0.001 / 0.048
MAL / 0.23 / 625 / -0.02 / 0.004 / 0.038 / 0.044
MAT / 0.00 / 1555 / 0.01 / 0.003 / 0.026 / 0.024 / 0.031
PCA / 0.01 / 245 / -0.01 / 0.005 / 0.029 / 0.023 / 0.033 / 0.007
ROC / 0.08 / 615 / 0.02 / 0.008 / 0.018 / 0.031 / 0.025 / 0.012 / 0.013
SJE / 0.00 / 796 / 0.00 / 0.003 / 0.036 / 0.017 / 0.043 / 0.008 / 0.015 / 0.02
SMA / 0.03 / 618 / 0.02 / 0.010 / 0.035 / 0.041 / 0.01 / 0.024 / 0.025 / 0.021 / 0.035
TRI / 0.00 / 420 / 0.02 / 0.008 / 0.01 / 0.036 / 0.029 / 0.018 / 0.022 / 0.012 / 0.03 / 0.029
2008
RIVER / Stocking / Nc / Fis / Fst intra / GOD / GPA / MAL / MAT / PCA / ROC / SJE / SMA
GOD / 0.08 / 615 / 0.02 / 0.006 / Fst inter
GPA / 0.12 / 150 / 0.00 / -0.001 / 0.045
MAL / 0.15 / 931 / 0.03 / 0.001 / 0.033 / 0.04
MAT / 0.00 / 1977 / -0.01 / 0.004 / 0.028 / 0.019 / 0.023
PCA / 0.05 / 285 / -0.01 / 0.004 / 0.028 / 0.018 / 0.022 / 0.007
ROC / 0.04 / 615 / 0.01 / 0.007 / 0.02 / 0.032 / 0.021 / 0.015 / 0.015
SJE / 0.00 / 947 / 0.01 / 0.007 / 0.036 / 0.012 / 0.03 / 0.01 / 0.008 / 0.02
SMA / 0.03 / 743 / 0.01 / 0.006 / 0.039 / 0.041 / 0.007 / 0.02 / 0.023 / 0.023 / 0.028
TRI / 0.00 / 838 / 0.02 / 0.004 / 0.015 / 0.038 / 0.027 / 0.022 / 0.024 / 0.015 / 0.031 / 0.033
Average for the three years
RIVER / Stocking / Nc / Fis / Fst intra / GOD / GPA / MAL / MAT / PCA / ROC / SJE / SMA
GOD / 0.05 / 741 / 0.01 / 0.007 / Fst inter
GPA / 0.08 / 179 / 0.00 / 0.002 / 0.049
MAL / 0.21 / 715 / 0.01 / 0.002 / 0.038 / 0.045
MAT / 0.00 / 1677 / 0.01 / 0.003 / 0.028 / 0.022 / 0.030
PCA / 0.02 / 289 / -0.01 / 0.003 / 0.029 / 0.022 / 0.030 / 0.006
ROC / 0.05 / 766 / 0.01 / 0.008 / 0.018 / 0.035 / 0.024 / 0.015 / 0.016
SJE / 0.00 / 887 / 0.01 / 0.007 / 0.036 / 0.015 / 0.041 / 0.009 / 0.011 / 0.022
SMA / 0.05 / 702 / 0.01 / 0.008 / 0.039 / 0.042 / 0.009 / 0.024 / 0.026 / 0.023 / 0.033
TRI / 0.00 / 674 / 0.02 / 0.004 / 0.015 / 0.038 / 0.030 / 0.021 / 0.024 / 0.013 / 0.030 / 0.031

Supplementary material 3. . Tests for correlations between Fis and Stocking (expected ratio of hatchery-origin adults), Fis and Nc (Population census size), Fst intra-population and Stocking, Fst intra-population and Nc, over the 27 samples.