6
Supplementary information
Materials and methods.
Cells, viruses and proteins. HLREFs, HSFs, A549, HCT116, U2OS, H1299, Ad5 293 and Ad5 911 cells were grown and maintained in HEPES-buffered Dulbecco’s modified Eagle’s medium (DMEM) containing 2 mM glutamine and 10% foetal calf serum (FCS). Sf9 cells were grown and maintained in TC100 medium containing 2 mM glutamine and 10% FCS. Adenoviruses used in this study were grown in Ad5 293 cells; viral titre was determined by plaque assay using Ad5 911 cells. A His6.p300-expressing baculovirus was used to infect Sf9 cells; His6.p300 was purified by metal-chelate affinity chromatography1. The APC/C was immunopurified from HeLa cells2.
Plasmids and DNA oligonucleotides. APC5 and APC7 constructs were cloned into pcDNA3.1 (Invitrogen), and pCMV-Tag3b (Stratagene) for mammalian expression and pGEX-4T-1 (Amersham Pharmacia) for bacterial expression. pGEX-CBP constructs have been described previously3. Ad5 12S E1A and p53 constructs were cloned into pcDNA3.1. pCMVb-p3004, pcDNA3.1-Gal4DBD5, pcDNA3.1-Gal4DBD-p3005, p21CIP1/WAF1 luciferase (pWWP luc)6, activated N-ras7, Ad5 E1B-55K7, (E2F)3TKCAT8, CMV-E2F-18, CMV-DP-18 and CMV-b-galactosidase9 have all been described previously. pBS/U6 for shRNA expression10 was supplied by S. Ross. Gal4-luciferase was supplied by J. S. Mymryk. DNA oligonucleotides were from Alta Bioscience, The University of Birmingham, U.K. Primers used in PCR to amplify the p53-binding site of the p21 promoter from immunoprecipitated DNA were: 5’-ccagccctttggatggtttgtatgtataggagcga and 3’-gcctcctttctgtgcctgaaacatttgcagttttg. The PCR products were amplified 30 cycles, to give rise to a 419 basepair fragment. Samples were analysed by TBE-agarose gel electrophoresis. cdc6 promoter elements were detected using 5’ (-174)-cctcacagcgactctaagacttggggctct and 3’ (+43)-tgaacaaactgcacagcggcagcagcaaac oligonucleotides as primers, giving rise to a 217 base-pair fragment following PCR.
Antibodies. Monoclonal antibodies (mAbs) were raised against residues 153-755 of human APC5 and residues 1195-1810 of human p300 (BMSU, The University of Birmingham). p300 mAb and rabbit polyclonal antibodies (pAbs; [#333]) recognise both CBP and p300. pAbs were raised against full-length APC7 (BMSU, The University of Birmingham). CBP-NT, CBP-CT, acetyl-histone H3 and H4, phospho H3 (Ser10) and histone H3 pAbs were from Upstate Biotechnology. p53 DO-1, E1A M73, APC3 (AF3.1) and myc epitope 9E10 mAbs were grown as hybridoma supernatants. CBP (A-22), p300 (N-15; C-20), APC6 (H-300), APC8 (H-300), p21CIP1/WAF1 (C-19), cyclin A (C-19), E2F-1 (C-20) pAbs and CBP (C-1) and Cdc20 (H7) mAbs were from Santa Cruz Biotechnology. APC2 (Ab-1) pAb and Cdh1 (DH01) mAbs were from NeoMarkers. b-actin (AC-74) and a-tubulin (B512) mAbs were from Sigma. Plk1 (BL978) pAb was from Bethyl. Acetyl-p300 (H499) pAb was from Cell Signalling Technologies. Cyclin B1 mAb was from Cancer Research U.K. Anti-mouse Alexa 488 and anti-rabbit Alexa 594 fluorophores were from Molecular Probes. Anti-BrdU FITC was from BD Biosciences.
SDS-PAGE and western blot analysis. Protein concentrations were determined by Bradford assay (BIO-RAD). Samples were fractionated on polyacrylamide gels, run in the presence of 0.1 M Tris, 0.1 M Bicine and 0.1% SDS. Separated proteins were electroblotted onto nitrocellulose filters (Gelman Sciences) and hybridised with the appropriate antibodies. Antigens were visualised by enhanced chemiluminescence (ECL, Amersham).
Supplementary references
1. Kraus, W. L., & Kadonaga, J. T. p300 and estrogen receptor cooperatively activate transcription via differential enhancement of initiation and re-initiation. Genes Dev. 12, 331-342 (1998).
2. Yamano, H., Gannon, J., Mahbubani, H. & Hunt, T. Cell cycle-regulated recognition of the destruction box of cyclin B by the APC/C in Xenopus egg extracts. Mol. Cell 13, 137-147 (2004).
3. Austen, M., Luscher, B. & Luscher-Firzlaff, J. M. Characterization of the transcriptional regulator YY1. The bipartite transactivation domain is independent of interaction with the TATA box-binding protein, transcription factor IIB, TAFII55, or cAMP-responsive element-binding protein (CBP)-binding protein. J. Biol. Chem. 272, 1709-1717 (1997).
4. Eckner, R. et al. Molecular cloning and functional analysis of the adenovirus E1A-associated 300-kD protein (p300) reveals a protein with properties of a transcriptional adaptor. Genes Dev. 8, 869-884 (1994).
5. Yuan, W., Condorelli, G., Caruso, M., Felasani, A. & Giordano, A. Human p300 protein is a coactivator for the transcription factor MyoD. J. Biol. Chem. 271, 9009-9013 (1996).
6. El-Deiry, W. S et al., WAF1, a potential mediator of p53 tumor suppression. Cell 75, 817-825 (1993).
7. Byrd, P. J., Grand, R. J. A. & Gallimore, P. H. Differential transformation of primary human embryo retinal cells by adenovirus E1 regions and combinations of E1A and ras. Oncogene 2, 477-484 (1988).
8. Trouche, D., Cook, A., Kouzarides, T. The CBP co-activator stimulates E2F1/DP1 activity. Nucleic Acids Res. 24, 4139-4145 (1996).
9. Zhang, X. et al. Transcriptional Regulation of the Human Glycoprotein Hormone Common Alpha Subunit Gene by CBP/p300 and p53. Biochem J. 368, 191-201 (2002).
10. Sui, G. et al. A DNA vector-based RNAi technology to suppress gene expression in mammalian cells. Proc. Natl. Acad. Sci. U S A. 99, 5515-5520 (2002).
Supplementary Figure legends
Figure S1. CBP/p300 association with the APC/C is not dependent upon cell cycle status. Asynchronously growing A549 cells were fractionated using a Beckman Coulter Avanti J-20 XP centrifuge to obtain fractions enriched in G1, S and G2/M phases of the cell cycle. Fractionated cells were washed with isotonic saline and either solubilised in buffer for immunoprecipitation (Methods), or treated with RNase A (10 mg/ml) and pepsin (2 mg/ml), labelled with propidium iodide (5 mg/ml) and subjected to flow cytometry (Methods). In each instance, CBP and p300 were immunoprecipitated from 1 mg of protein lysate from each corresponding fraction, and subjected to SDS-PAGE and Western blotting for APC5. cyclin A and cyclin B1 protein levels are shown to indicate the relative cell cycle positions. The % of cells in G1, S and G2/M were as follows: Fraction 1: G1-95, S-5, G2/M-0; Fraction 2: G1-78, S-22, G2/M-0; Fraction 3: G1-4, S-88, G2/M-8; Fraction 4: G1-0, S-43, G2/M-57; Fraction 5: G1-0, S-8, G2/M-92.
Figure S2 a and b, Binding of GST-CBP (1460-1891) to APC5, APC7 and E1A N-terminal homology deletion mutants and CR1 homology domain mutants, respectively. Conserved residues in the CR1 motif FXD/EXXXL have been mutated to ala.
Figure S3. Effects of APC5 and APC7 gene ablation upon HSF cell cycle status. HSFs were treated with either: a, non-silencing RNA; b, APC5 siRNA; c, APC7 siRNA; or d, APC5 and APC7 siRNA. 72 h post-transfection, cells were incubated with 10 mM BrdU for 4 h. After this time, cells were treated with RNase A (10 mg/ml) and pepsin (2 mg/ml), labelled with propidium iodide (0.5 mg/ml) and subjected to flow cytometry (Methods). e, western blot analysis of APC5, APC7 and b-actin levels following treatment with siRNAs.
Figure S4. a and b, Silver-staining of His6-p300 and APC/C preparations following SDS-PAGE. c and d, the effect of APC5, APC7, Cdc20 (sense: AAGACCTGCCGTTACATTCCTTT) and Cdh1 (sense: AATGAGAAGTCTCCCAGTCAGTT) gene ablation by RNAi upon CBP and p300 protein levels in HSFs.
Figure S5. Regulation of CBP/p300-dependent activation of E2F-1/DP-1 by the APC/C. a, APC5 and APC7 enhance CBP/p300-dependent transcription of an E2F-1-responsive CAT reporter gene. HCT116 cells were transfected with 1 mg of the (E2F)3TKCAT reporter construct, in the presence of varying combinations of 100 ng of CMV-E2F-1 and CMV-DP-1, 500 ng of pRc/RSV-CBP or pCMVb-p300, and 500 ng of pcDNA3.1-APC5 or pcDNA3.1-APC7. Results are from at least two independent experiments and expressed ± S.D. b, association of the APC/C with the cdc6 promoter in vivo; regulation of promoter acetylation by the APC/C. upper panel: A549 cells were cross-linked with 1% (v/v) paraformaldehyde and subjected to ChIP analysis using the appropriate antibodies. Immunoprecipitated DNA was probed for cdc6 promoter elements by PCR. middle panel: A549 cells were treated with siRNAs directed against APC5 and APC7 (corresponding western blots, c). Cells were subsequently cross-linked with 1% (v/v) paraformaldehyde and subjected to ChIP analysis using an anti-acetyl-H4 antibody. Immunoprecipitated DNA was probed for cdc6 promoter elements by PCR. b, lower panel: acetylation status of the cdc6 promoter in A549 cells following over-expression of APC5 and APC7. After transfection cells were cross-linked with 1% (v/v) paraformaldehyde and subjected to ChIP analysis using an anti-acetyl-H4 antibody. Immunoprecipitated DNA was probed for cdc6 promoter elements by PCR (lanes 2 and 5, pcDNA3.1 alone; lanes 3 and 6, E2F-1/DP-1 + CBP; lanes 4 and 7, E2F-1/DP-1 + CBP + APC5/APC7). d, APC8 association with the cdc6 promoter is dependent upon APC5 and APC7 expression. A549 cells were treated with siRNAs directed against APC5 and APC7 (corresponding western blots, e), subsequently cross-linked with 1% (v/v) paraformaldehyde and subjected to ChIP analysis using anti E2F-1 and APC8 antibodies. Immunoprecipitated DNA was probed for cdc6 promoter elements by PCR. f, CBP/p300-dependent recruitment of APC/C subunits to the cdc6 promoter. A549 cells were treated with siRNAs directed against CBP and p300 (corresponding western blots, g). Cells were subsequently cross-linked with 1% (v/v) paraformaldehyde and subjected to ChIP analysis using the appropriate antibodies. Immunoprecipitated DNA was probed for cdc6 promoter elements by PCR.
Figure S6. APC5 and APC7 co-localize with CBP and acetylated histone H3 in A549 interphase cells. Cells were grown on glass coverslips, fixed in 4% (w/v) paraformaldehyde in PBS, subsequently permeabilised in ice-cold acetone and then subjected to immunofluoresence (Methods). A-C, cells were co-stained for APC5 (green) and CBP (red). D-F, cells were co-stained for APC7 (red) and CBP (green). G-I, cells were co-stained for APC5 (green) and acetylated histone H3 (red). DAPI, blue. Large arrowheads indicate coincident staining; small arrowheads indicate partial co-staining.
Figure S7. a, GST pull-down using A549 cell lysates, showing CBP/p300 interaction with APC5 mutants. b and c, GST pull-downs demonstrating that APC5 and APC7, respectively, compete with E1A for binding to CBP.
Figure S8. E1A targets APC5 and APC7 during the transformation process. HLREF cells were transfected with E1A and activated N-ras in the presence of either, non-silencing RNA oligonucleotides, or siRNAs complementary to APC5 (AACCTCCGTGTTCAAGATGTTTT), APC7 (AAGAGCGATCAACACCATCTGTT) or APC5/7 gene sequences. The appropriate vectors expressing shRNAs directed against APC5 (GGGCAGAAGAGAGCCGATAGCT) and APC7 (GGGATCCCTTCAAGACAAAGAA) were also included in the transformation assay. Gene knock-down of APC5 and APC7 enhanced RG2 E1A-mediated, but not wild-type E1A-mediated, transformation of HLREFs (panel 1 and 2), Data are from three independent experiments ± S.D. Western blot analysis of APC5, APC7 and b-actin in HLREFs treated as above (panels 3-5).
Figure S9. APC5 co-localizes with CBP during mitosis in A549 cells. Cells were grown on glass coverslips, fixed in 4% (w/v) paraformaldehyde in PBS, subsequently permeabilised in ice-cold acetone and then subjected to immunofluoresence. A-C, prophase; D-F, premetaphase; G-I, metaphase; J-L, anaphase. APC5, green; CBP, red; DAPI, blue. Arrowheads indicate coincident staining.
Figure S10. a, A proposed model for APC/C-dependent regulation of CBP/p300-directed A-T activity. The association of either APC5 or APC7 with CBP/p300 positively regulates CBP/p300 A-T activity directed towards promoter-bound histones, promoting transcriptional activation. b, a model for CBP/p300-dependent regulation of the APC/C E3 ubiquitin ligase activity. CBP/p300 through association with either APC5 or APC7 functions as an E4 ligase, in the presence of the appropriate E2 ubiquitin-conjugating enzyme and activator proteins, promoting APC/C-mediated ubiquitylation of substrate molecules. E1A selectively competes with APC5 and APC7 for CBP/p300 to regulate transcription, cell cycle progression and cellular transformation. Ac, acetylation; Ub, ubiquitin.