Supplementary Information s15
Supplementary information
Production of avian retroviruses and tissue-specific somatic retroviral gene transfer in vivo by using the RCAS/TVA system
By Alexander von Werder*, Barbara Seidler*, Roland M. Schmid, Günter Schneider and Dieter Saur
Supplementary method 1:
Genotyping protocol for LSL-R26Tva-lacZ/+, Ptf1aCre/+ and Prm-Cre animals
LSL-R26Tva-lacZ (with lox-stop-lox (LSL) cassette; for additional information see also Supplementary Fig. 1A/B and Seidler et al. 1) and R26 wild type allele
Primers:
R26-Tva-UP (forward primer): 5´-AAAGTCGCTCTGAGTTGTTAT-3´
R26-Tva-SA-mut-LP (reverse primer; specific for splice acceptor of transgene; see Supplementary Figure 1 and Seidler et al.1: 5´-GCGAAGAGTTTGTCCTCAACC-3´
R26-Tva-WT-LP (reverse primer): 5´-GGAGCGGGAGAAATGGATATG-3´
PCR (note: all PCR are performed without “hot start”):
0.6 µl R26-Tva-UP primer (10 mM stock)
0.4 µl R26-Tva-SA-mut-LP primer (10mM stock)
1.0 µl R26-Tva-WT-LP primer (10 mM stock)
15 µl Sigma REDTaq® ReadyMix™ PCR Reaction Mix (Sigma-Aldrich, cat. no. R2523)
2 µl DNA
11 µl H2O
Conditions:
95 °C 3 min
95 °C 45 sec, 62°C 1 min, 72°C 1 min 30 sec; 40 Cycles
72°C 7 min
25°C Hold
PCR product:
310 bp (mutant R26Tva-lacZ allele)
600 bp (wildtype R26 allele)
Detecting TVA cDNA or genomic DNA in the mouse, regardless of the TVA strain (for additional information see also Supplementary Fig. 1A/C)
Primers:
Tva-UP (184) (forward primer): 5´-TACCCGCAGGACTGGCTGT-3´
Tva-LP (521) (reverse primer): 5´-GCCACCATCCAGACCCATT-3´
PCR:
1 µl Tva-UP (184) primer (10 mM stock)
1 µl Tva-LP (521) primer (10mM stock)
15 µl Sigma REDTaq® ReadyMix™ PCR Reaction Mix (Sigma-Aldrich, cat. no. R2523)
2 µl DNA
11 µl H2O
Conditions:
95 °C 3 min
95 °C 45 sec, 65°C 1 min, 72°C 1 min 30 sec; 40 Cycles
72°C 7 min
25°C Hold
PCR product: 340 bp (Tva DNA or cDNA)
Integrity of lox-stop-lox (LSL) cassette (before Cre mediated recombination; for additional information see also Supplementary Fig. 1A/D)
Primers:
pA-pause-UP (forward primer): 5´-ATAGTTAATTGGAGCGGCCGCAATA-3´
Tva-LP (353) (reverse primer): 5´-CATCTCACCAGCTCACAGCAA-3´
PCR:
1 µl pA-pause-UP primer (10 mM stock)
1 µl Tva-LP (353) primer (10mM stock)
15 µl Sigma REDTaq® ReadyMix™ PCR Reaction Mix (Sigma-Aldrich, cat. no. R2523)
2 µl DNA
11 µl H2O
Conditions:
95 °C 3 min
95 °C 45 sec, 58°C 1 min, 72°C 1 min 30 sec; 40 cycles
72°C 7 min
25°C Hold
PCR Product:
630 bp (intact stop cassette (LSL) in R26 locus of LSL-R26Tva-lacZ mice)
Deletion of LSL cassette due to Cre mediated recombination (or additional information see also Supplementary Fig. 1A/E; alternatively X-gal staining of tissues or tissue cryosections can be used to detect lacZnls expression and thus demonstrate deletion of the LSL cassette)
Primers:
R26-Tva-UP (forward primer): 5´-AAAGTCGCTCTGAGTTGTTAT-3´
Tva-LP (353) (reverse primer): 5´-CATCTCACCAGCTCACAGCAA-3´
PCR:
1 µl R26-Tva-UP primer (10 mM stock)
1 µl Tva-LP (353) primer (10mM stock)
15 µl Sigma REDTaq® ReadyMix™ PCR Reaction Mix (Sigma-Aldrich, cat. no. R2523)
2 µl DNA
11 µl H2O
Conditions:
95 °C 3 min
95 °C 45 sec, 53°C 1 min, 72°C 1 min 30 sec; 40 cycles
72°C 7 min
25°C Hold
PCR product: 730 bp (deleted stop cassette (LSL) in R26 locus of LSL-R26Tva-lacZ mice); sometimes an unspecific band at 400 bp is present)
Ptf1aCre and Ptf1a wild type allele
Primers:
Ptf1a-WT-UP (forward primer): 5´-CCACGGATCACTCACAAAGCGT-3´
Ptf1a-Cre-mut-UP (forward primer; specific for mutant Ptf1aCre allele (knock-in of Cre into the ATG start codon of the endogenous Ptf1a locus)): 5´-GCCACCAGCCAGCTATCAA-3´
Ptf1a-LP (reverse primer): 5´-CCTCGAAGGCGTCGTTGATGGACTGCA-3´
PCR:
1.5 µl Ptf1a-WT-UP primer (10 mM stock)
0.5 µl Ptf1a-Cre-mut-UP primer (10mM stock)
1.9 µl Ptf1a-LP primer (10 mM stock)
15 µl Sigma REDTaq® ReadyMix™ PCR Reaction Mix (Sigma-Aldrich, cat. no. R2523)
2 µl DNA
3 µl Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, cat. no. D2438)
! CAUTION DMSO is toxic, carcinogenic, teratogenic, volatile and readily absorbed through the skin.
6.1 µl H2O
Conditions:
95 °C 3 min
95 °C 45 sec, 60°C 1 min, 72°C 1 min 30 sec; 40 cycles
72°C 7 min
25°C Hold
PCR product:
400 bp (mutant Ptf1aCre allele)
600 bp (wildtype Ptf1a allele)
Prm-Cre PCR (detects Cre DNA in any setting; not specific for Prm-Cre transgene)
Primers:
Cre-UP (forward primer): 5´- CCTGGAAAATGCTTCTGTCCG -3´
Cre-LP (reverse primer): 5´- CAGGGTGTTATAAGCAATCCC -3´
PCR:
1 µl Cre-UP primer (10 mM stock)
1 µl Cre-LP primer (10mM stock)
15 µl Sigma REDTaq® ReadyMix™ PCR Reaction Mix (Sigma-Aldrich, cat. no. R2523)
2 µl DNA
11 µl H2O
Conditions:
95 °C 3 min
95 °C 45 sec, 58°C 45 sec, 72°C 1 min; 40 cycles
72°C 7 min
25°C Hold
PCR product: 390 bp (Cre)
REFERENCES
1. Seidler, B. et al. A Cre-loxP-based mouse model for conditional somatic gene expression and knockdown in vivo by using avian retroviral vectors. Proc Natl Acad Sci U S A 105, 10137-10142 (2008).
1