Supplementary Information: Farrall & Whitelaw (2009) SIM2s repression of the pro-cell death gene, BNIP3
SUPPLEMENTARY INFORMATION
Materials and methods:
Plasmids and expression vectors
1.2kb of the mouse BNIP3 promoter was amplified from NIH3T3 genomic DNA, made using Purelink Genomic DNA purification Kit (Invitrogen), using Pfu Turbo polymerase (Stratagene) as per manufacturers’ instructions. Primers; sense: 5- ATGAGGAGCTCTTGGGGAACTATGGGTCAAC -3’, and antisense: 5’- GTATCGCTAGCAGCAAGCCAGGGGTAAAGAT -3’. Subcloned Sac1/Nhe1 into pGL3-Basic (Promega). 1kb mBnip3 promoter then excised and ligated into native pGL3basic, Xho1/Xho1. Site directed mutagenesis of mBnip3 regulatory region HRE 5’-CACGTG-3’ and S2RE 5’-AACGTG-3’, binding sites to mutant 5’-AAAAAG-3’ sites, was carried out using the following primers: HRE; sense: 5’-CCGGCGCACGCGCCGAAAAAGCCACACGCTCCC-3’, antisense: 5’- GGGAGCGTGTGGCTTTTTCGGCGCGTGCGCCGG-3’. S2RE; sense: 5’- GTACTGGGGACAGAACCAGATCTGAAAAAGCTGGGTAAGTGCTC-3’, antisense: 5’- GAGCACTTACCCAGCTTTTTCAGATCTGGTTCTGTCCCCAGTAC-3’, using Quickchange site-directed mutagenesis kit (Stratagene). pCMX-b-galactosidase vector (gift, D. Dowhan), and pEF/hSIM2s(Myc)2/IRESpuro and pEF-BOS-hARNT1.HA, described previously (Woods et al., 2008) were also used.
Cell Culture and production of stable polyclonal cell lines
Human pancreatic, PANC-1 and CFPAC, and prostate, DU145, LNCaP and PC3AR+, carcinoma derived cells were maintained in RPMI (Gibco) supplemented with final concentration of 1mM sodium pyruvate (Gibco), and mouse NIH3T3 and P19 cells were maintained inDulbecco’s modified Eagle’s medium (Invitrogen), and Alpha-MEM (Gibco), respectively. All growth media supplemented with 10% foetal bovine serum (FBS, Gibco) androutinely maintained at 37˚C, 5% CO2.Subconfluent cells were transfected using Fugene6 (Roche) as per manufacturers instructions. To produce stably transfected polyclonal lines, subconfluent cells were transfected with blank pEF/IRESpuro or pEF/hSIM2s(Myc)2/IRESpurovectors and were selected and expanded with up to 10µg/ml puromycin (Sigma).
Immunoblot
Whole cell extracts (WCE) were prepared as described previously (Woods & Whitelaw, 2002) with minor variation.35-50μgWCE,in SDS load buffer, were subjected to SDS-PAGE (8-13.5% gel), and then transferred to nitrocellulose using wet or semi-dry transfer (Biorad). Immunoblot detection was done using the following antibodies; anti-ARNT1#51 (Woods & Whitelaw, 2002),anti-Myc 4A5 (Abcam), anti-HIF1α mAb (BD Biosciences), anti-ARNT MA515 (Affinity BioReagents), anti-LC3B (Abcam), anti-alpha-Tubulin (Serotec),anti-Actin (Sigma), anti-SQSTM1/p62 (Santa Cruz), anti-hSIM2s (Santa Cruz),anti-BNIP3 (Sigma); anti-HIF1α-CAD (Richard etal., 1999) was used for detection of mouse HIF1α.Horseradish peroxidase-conjugatedsecondary antibodies used were anti-goat, anti-mouse, anti-rabbit (Pierce), and anti-rat (Dako), and detected using either Super Signal (Pierce), or Imobilon (Millipore) chemiluminesence reagents. Densitometric quantitation of SQSTM1/p62, BNIP3 and LC3-II chemiluminesent immunoblot data was done using ImageQuant v5.2(Molecular Dynamics) software, from n=3-4 independent experiements.
Immunoprecipitation (IP)
0.5mg of DU145 WCE was diluted to ~1.6μg/μl in IPbuffer (250mM NaCl, 20mM HEPES pH 8.0, 0.1% NP40, 1mM EDTA) plus fresh 1x Protease Inhibitor (PI) cocktail from 100x stock (Sigma), then pre-cleared using rec-proteinG-sepharose (Zymed). Pre-cleared diluted WCE was then mixed with 2ug of goat polyclonal hSIM2s or IgG control antibodies (Santa Cruz), or no antibody, and mixed gently for 1h at 4C. Protein-antibody complexes were then conjugated to rec-proteinG-sepharose (Zymed) for 2h with gentle mixing at 4C, followed by 4x washes with IP buffer. Final pellet was resuspended in SDS load buffer, boiled, and separated by 8% SDS-PAGE, followed by transfer to nitrocellulose for immunoblot analyses as described above.
Microarray
Two independently derived polyclonal DU145 cell lines with stable ectopic expression of myc tagged human SIM2s, and two independently derived polyclonal Control (empty-vector) puromycin resistant cell lines, were each grown in duplicate 75cm2 flasks, maintained in usual growth conditions and allowed to reach 80-90% confluency prior to harvesting.Total RNA was extracted using Tri-Reagent (Ambion) and purified using Qiagen RNeasy mini kit (Qiagen). 20ug of purified total RNA for each sample, 8 samples in total, representing 2xControl, 2xSIM2s polyclonal cell lines, each grown in duplicate, from which independent RNA extracts were made,was supplied to the Adelaide Microarray Facility (Adelaide, SA, Australia), who performed all cDNA synthesis and dye labelling reactions. Labelled cDNA was subsequently hybridised to a human 19K oligonucleotidearray chip(Adelaide Microarray Facility, SA, Australia). All data compilation and statistical analysis was completed by the Adelaide Microarray Facility.
siRNA Oligonucleotide Treatments
siRNA oligonucleotides were chemically synthesized (Qiagen). 100nM of siRNA oligos were transfected into 25-30% confluent cells using Oligofectamine (Invitrogen) as per manufacturers’ instructions, and repeated 24 hours later. Cells were then harvested 72 hours after first transfection for analysis. Or, DU145 cells, transduced with lentiviral vector (gift, S. Barry) (Drabsch etal., 2007) containing tet-inducible shRNA sequences for targeting SIM2s and scrambled control,were treated with doxycycline for 72hrs, then harvested. Target sequences for siRNA oligos are as follows: siControl: 5’- aacgtacgcggaatacaacga-3’ (Sanchez et al., 2004); siScrambled: 5’- gtactaccgttgttataggtg-3’ (sequence ex. Ambion); siSIM2s-1759: 5’-aaccctcacgctttgggcaaa-3’; and siPanSIM2-2: 5’- cacgctttttcctgagcacaa-3’.
Total RNA extractions and cDNA synthesis
Total RNA was chloroform extracted from cells lysed with Tri-reagent (Ambion), and then purified and eluted from RNA-easy mini columns (Qiagen) as per manufacturers instructions. cDNA was synthesised from 1-2μg of total RNA using Superscript III (Invitrogen) reverse transcriptase as per manufacturers instructions.
Semi-quantitative and quantitative Real-Time RT-PCR
Semi-quantitative PCR was performed using Biotaq polymerase (Bioline) as per manufacturers’ instructions, plus final concentration of 1M betaine (Sigma). Primers used see Supplementary Tables 1 and 2. Number of cycles used optimised for each primer set. General PCR program: denature 94C for 5’, then limiting cycles of 94C, 30”; 60C, 30”; 72C, 30”. Single PCR amplicons were separated by 1% agarose gel electrophoresis stained with ethidium bromide (EtBr) and visualised by UV detection. Real-time PCR was carried out using Platinum SYBR Green qPDR Supermix-UDG reagent (Invitrogen) as per manufacturers instructions, and PCR performed and analysed using StepOne Plus Real-time PCR system (Applied Biosystems) and ‘QGene’ analysis software(Muller et al., 2002).
Bioinformatic analysis of BNIP3 regulatory region
‘TESS’ (Transcription Element Site Search) online software searches for putative SIM2 Response Elements (S2REs), 5’-AACGTG-3’; Bioinformatic epigenetic analysis of corresponding region of the human [-1162 to +538] and mouse [-1120 to +580] BNIP3 regulatory regions was performedusing ‘Methprimer’and ‘EMBL EMBOSS’ online software; and respectively.
Hypoxia treatments
Cells grown in 10cm dishes, or 6- and 24-well trays, were sealed in a hypoxia chamber with a hypoxia sachet (Aerogen) to achieve 0.2% Oxygen (O2), and incubated as usual for the designated number of hours prior to harvesting for experimental analyses. Percent oxygen concentration using this system was determined utilising the oxygen sensing device from Teledyne Analytical Instruments(model AX3001). Prolonged ‘hypoxia’ was also induced using or 1mM Dimethyloxallyl glycine (DOMG, Chemicon), or 100μM dipyridyl (DP, Sigma), compared to DMSO (Dimethyl sulfoxide, Sigma) vehicle control treatment, from 1000x stocks, or prolonged growth in a hypoxia chamber as described above.
Chromatin Immunoprecipitation (ChIP)
Subconfluent NIH3T3 cells with or without 8 hours of hypoxia were fixed with final concentration of 1% Formaldehyde (Sigma) for 10 minutes, stopped by 128mM final concentration of 1.67M glycine. Cells were then harvested and washed twice with cold PBS. Cells were then lysed in freshly made Nuclear Isolation Buffer; 5mM PIPES (Sigma) pH 8, 85mM KCl, 0.5% Igepal (Sigma) and 1xPI cocktail (Sigma). The nuclear pellet from approximately 2x106 cells (for one IP sample) was then resuspended in 200μl freshly made SDS lysis sonication buffer plus 1xPIs as per Ez-ChIP kit protocol (Upstate), and snap frozen in an ethanol/dry ice bath. Nuclear pellets in sonication buffer were thawed and then sonicated using the Bioruptor (Diagenode), set on high for 30” on/30” off for 7.5-10 minutes. ChIP was then performed as per Ez-ChIP protocols, using 5ug of goat polyclonal anti-hSIM2s (Santa Cruz), goat-polyclonal IgG (Santa Cruz), rabbit polyclonal anti-HIF1α (ab2185, Abcam), and rabbit polyclonal IgG (Upstate) antibodies for immunoprecipitations. Eluted ChIP DNA was purified using Qiagen DNA purification Spin column (Qiagen), and thenanalysed by PCR, see supplementary table 3 for primer sequences, using Biotaq polymerase (Bioline) as per manufacturers instructions, supplemented with 1M betaine (Sigma).PCR program used as described above, using 38-40x cycles. Primers used see Supplementary Table 3. PCR products visualised by EtBr stained 2.5% w/v TBE agarose gel electrophoresis.
Luciferase/Beta-galacosidase Reporter assays
Transient transfection of NIH3T3 cells at 30% confluency in 24-well tray format was performed using Fugene6 (Roche). Each transfection contained equal final DNA levels, including 100ng of PGL3basic luciferase reporter construct with 100ng pCMX-beta-galactosidase(gift D. Dowhan), with 100ngof SIM2s expression vector, with or without 10ng carboxy-terminal heamagglutinin tagged hARNT1. 24hours later cells were either harvested or subjected to an additional incubation for 16 hours in a hypoxia chamber. Cells were lysed with 100μl1xPassive Lysis Buffer (Promega). 10μl of each lysate was analysed in 96 well tray format for measurement of luciferase activity, using 50μl Luciferase Assay Substrate (Promega), followed by Galacto-light substrates (Applied Biosystems): 70μl Galacto-light, 1 hour incubation, then addition of 100μl Galacto-light Accelerator, for analysis of control beta-galactosidasefor normalisation, as per manufacturers instructions, using the Glomax (Promega) system.
Cell survivalassay
PC3AR+ cells were seeded at 1.3x104cells/well (100μl) in 96 well trays, and allowed to adhere overnight. Cells were then treated for the indicated hours with either DMSO vehicle control, DMOG or DP. At time of harvest 10μl WST-1 reagent (Roche) was added to the wells as per manufacturers instructions. Cells were then incubated in usual growth conditions and incubation time with WST-1 reagent was optimised according to manufacturers’ instructions. WST-1 signal was measured at 450nm on a plate Spectramax reader (Molecular Devices). Data represented as percent of cell survival (mitochondrial activity) of respective DMSO vehicle treated puromycin resistant Control, or SIM2s.myc cells, at each time point.
Supplementary Table 1: Semi-Quantitative RT-PCR primer sequences
5’- 3’ / Sense / AntisensehSIM2s
DeYoung et al., (2003a) PNAS, 100, 4760-5 / tggaggaccgccttgtctacct / gcccaaagcgtgagggttctgtct
hBNIP3 / gacggagtagctccaagagc / ctggtggaggttgtcagacg
mBNIP3 / cagcatgaatctggacgaag / tccaatgtagatccccaagc
GAPDH / ggagccaaaagggtcatc / accaccctgttgctgtag
Supplementary Table 2: Real-Time quantitative-PCR primer sequences
5' - 3' / Sense / AntisensehBNIP3 / tgctgctctctcatttgctg / gactccagttcttcatcaaaaggt
hSIM2s / gggtcaggtctgctcgtg / aagcgtgagggttctgtctc
hPOLR2a / gagagtccagttcggagtcct / ccctcagtcgtctctgggta
Supplementary Table 3: ChIP PCR primer sequences
5' - 3' / Sense / AntisensemBNIP3 Proximal promoter HRE / cggtccacttctgcattaga / cactggactgagggacaagg
mBNIP3 Intron 1 S2RE site 1 / gaacgtgctgggtaagtgct / catcaggaagtggcaacaaa
mBNIP3 Intron 1 S2RE site 2 / tggaggaggatcctgttgac / aatcccagcactagggaggt
mACTIN intron 1
Anguita et al., (2004) Embo J, 23, 2841-52 / cggtgtgggcatttgatga / cgtctggttcccaatactgtgtac
mChromosome 7
(3kb upstream of mBNIP3) / ggggagggagtttttgagac / tgtgtcaggatctgggttca
SUPPLEMENTARY FIGURE S1:Endogenous heterodimerisation partner, ARNT1, is in excess to stably expressed myc tagged human SIM2s (SIM2s.myc) in human prostate DU145 cells. SIM2s.myc was immunoprecipitated from whole extracts of DU145/SIM2s.myc cells (10% input lane 3) using goat polyclonal anti-hSIM2s antibody (lane 4, lighter exposure panel).Control IPs were irrelevant anti-IgG antibody (lane 1) and anti-hSIM2s with no whole cell extract (lane 2). Co-immunoprecipitation of endogenous partner factor ARNT was detected by immunoblot using anti-ARNT1#51 (rabbit polyclonal) antibody, prior to detection of SIM2s. Analysis of whole cell extract immuno-depleted of SIM2s.myc shows ARNT1 remains in excess (lanes 6 & 7). Samples were separated by 8% SDS-PAGE, followed by immunoblot analysis of proteins as indicated. Panels pertaining to detection with individual antibodies are resultant of equal exposure time, except where shorter exposure time is indicated. Representative of two independent experiments. HC = heavy chain. * = non-specific background band.
SUPPLEMENTARY FIGURE S2:Native and mutant 1kb mBNIP3promoter-pGL3Basic reporter constructs were transfected into subconfluent NIH3T3 cells without (empty-vector Control), or with stable hSIM2s.myc expression. Luciferase activity was analysed 24h later and normalised to co-transfected beta-galactosidase levels. Luciferase activity with ectopic SIM2s expression (dark grey bars) is shown as percent activity of that observed from empty-vector Control cells (set at 100%, white bars). Data is an average from four (n=4) independent experiments, error bars SEM. Cells culture conditions, plasmid constructs, transfection conditions, primer sequences and sources of regents have been described in the Supplementary Information.
1