Supplementary figure 1A: Tumor cell purification does not the affect the expression of genes of the invasion signature. Cancer cells collected using the in vivo invasion assay were subjected to purification using magnetic beads to remove the co-migrating macrophages. This figure shows that the gene expression pattern is not altered during to this process. Gene expression was analyzed by QRT-PCR for the same genes before and after the bead separation and shows no significant change in the genes belonging to the invasion signature. In addition, this figure shows that the observed overexpression of Mena in the invasive cells is not due to the bead separation used to separate the macrophages. The error bars show standard errors of mean (SEM) performed on three biological repeats and three technical repeats.
Supplementary figure 1B: Effect of needle containment on the gene expression pattern of invasive tumor cells. In order to control for hypoxic conditions due to the needle containment of cells during the in vivo invasion assay we inserted average primary tumor cells in the microneedle for 4 hrs, the time required to perform the in vivo invasion assay. Gene expression analysis by QRT-PCR was performed before and after the needle containment and compared to that of invasive tumor cells as shown. These results demonstrate no significant change in the gene expression resulting from the containment of tumor cells in the microneedle. Similar results were obtained as shown previously (2, 3), when cells were exposed to EGF and matrigel, the other conditions of the in vivo invasion assay. In addition, this figure shows that the observed overexpression of Mena in the invasive tumor cells is not due to the containment of the cells in the microneedles during the in vivo invasion assay. The error bars show standard errors of mean (SEM) performed on three biological repeats and three technical repeats.
Supplementary figure 2: In vivo invasion Assay. In vivo invasion assay can be used to collect invasive tumor cells and accompanying stromal cells from living tumors. A) Model for in vivo invasion assay shows method for collecting cells from living tumors using needles (i.d. 100 μm) filled with matrigel and the ligand of interest when placed in the mammary tumor of an anesthetized animal (described previously in 2, 22, 23) B) Holding apparatus for 25 gauge guide needles and 33 gauge experimental needles is shown attached to micromanipulator used to precisely place needles into the mammary tumor. C) Living tumor in anesthetized mouse is shown with needles inserted. The needles are left in the tumor for up to 4 hours. D) Movement of tumor cells (top, WAP-Cre/CAG-CAT-EGFP/MMTV-PyMT tumor) and macrophages (bottom, MMTV-PyMT/lys-GFPKi) toward EGF-containing needles. The approximate opening of the collection needle is shown in the field as (*). Each image is a 50 μm z-projection from a time lapse series. Images on the right were recorded 90 minutes after images on the left. Scale bar = 25 μm.
Supplementary Figure 1A.
Supplementary Figure 1B.
Supplementary Table 1
Smart Primer I for RACE / AAGCAGTGGTATCAACGCAGAGTAC(T)30-VN
Smart Primer II for RACE / AAGCAGTGGTATCAACGCAGAGTACGCGGG
Pan Mena Forward/M1 / CGGCAGTAAGTCACCTGTCA
Pan Mena Reverse/M2 / CTTCAGCTTTGCCAGCTCTT
Forward primer for ++ and +++/3 / GATTCAAGACCATCAGGTTGTG
++ specific reverse primer/4 / CAATGTTGGCCCTAAATAGAA
+++ specific reverse primer/5 / TACATCGCAAATTAGTGCTGTC
++ specific forward primer for RACE/alpha4 / TTCTATTTAGGGCCAACATTG
+++ specific forward primer for RACE/alpha5 / GACAGCACTAATTTGCGATGT
External forward primer for 11a/6 / CCAACCAGAAAACCTTGGG
External reverse primer for 11a/7 / TGCTTCAGCCTCTCATAGTCA
11a specific reverse primer/13 / TTCTCCTTGGAGAATCCCG
Supplementary figure 2:
Page 1 of 5
Linking powered by eXtyles