Supplementary Figure 1. the Obtained Cdna Sequences of Patgl Gene

Supplementary figure 1. The obtained cDNA sequences of pATGL gene

Note: nucleotides with capital letter indicated open reading frame (ORF) of parrot ATGL (pATGL) gene, whereas lowercase letters indicated untranslated regions (UTR). Capital letter under nucleotides showed amino acid for each codon upside, and “*” referred to stop codon. Underlined amino acids indicated a 169-amino acid “patatin” domain. “GASAG” in box indicated a conservative “GXSXG” motif. These cDNA sequences of pATGL gene were available at NCBI with accession number of GQ221784.

(A)

(B)

Supplementary figure 2. Identity and phylogenetic analyses of ATGL among 14 species

Note: (A) Identities and divergence among 14 species. Numbers in left and below were divergence among 14 species based on ATGL gene cDNA sequences. Numbers in right upper were ATGL identities among 14 species. (B) Phylogenetic tree among 14 species constructed with ATGL gene cDNA.

Supplementary figure 3. The obtained cDNA sequences of qATGL gene

Note: nucleotides with capital letter indicated open reading frame (ORF) of quail ATGL (qATGL) gene, whereas lowercase letters indicated untranslated regions (UTR). Capital letter under nucleotides showed amino acid for each codon upside, and “*” referred to stop codon. Underlined amino acids indicated a 169-amino acid “patatin” domain. “GASAG” in box indicated a conservative “GXSXG” motif. These cDNA sequences of pATGL gene were available at NCBI with accession number of GQ221783.

Supplementary figure 4. The obtained cDNA sequences of dATGL gene

Note: nucleotides with capital letter indicated open reading frame (ORF) of duck ATGL (dATGL) gene. Capital letter under nucleotides showed amino acid for each codon upside, and “*” referred to stop codon. Underlined amino acids indicated a 169-amino acid “patatin” domain. “GASAG” in box indicated a conservative “GXSXG” motif.

Supplementary figure 5. Blast of amino acids at ATGL patatin domain

Note: the ATGL sequences used for blast were downloaded from NCBI database (http://www.ncbi.nlm.nih.gov/) as described by table 2. “.” indicated a same amino acid. The “GASAG” and “GCGFLG” with rectangle box indicated the active serine hydrolase motif (“GXSXG”) and the glycine rich motif (“GXGXXG”).

Supplementary table 1. Descriptions for 18 primer pairs used in this study.

Gene1 / Primer / Forward & Reverse / Nucleotides
(5' to 3') / AT2 (℃) / Purpose
qATGL / qPM1 / qPM1F / PM2 (Nie et al., 2009) / 62 / RT-PCR
qPM1R
qPM2 / qPM2F / atgttccctttggactccgc / 61 / RT-PCR
qPM2R / tcagaagagtggcaggcactc
qPM3 / qPM3F / UPM=5’RACE Material Kit / 68 / 5’RACE
qPM3R1 / cagcagactccagaggcagcatgtagg
qPM3R2 / ccagaggcagcatgtaggggacca
qPM4 / qPM4F / cccctacatgctgcctctggagtctgctg / 71 / 3’RACE
qPM4R / UPM=3’RACE Material Kit
qPM5 / qPM5F / gcctcccaaactgaaccaagctctt / 63 / Real time
qPM5R / tgctccctcatccatctaatatcctca
qACTIN / qPM6 / qPM6F / gccccacctgagcgcaaatac / 63 / Real time
qPM6R / tgcggtggacaatggagggt
pATGL / pPM1 / pPM1F / qPM1F / 62 / RT-PCR
pPM1R / qPM1R
pPM2 / pPM2F / qPM2F / 61 / RT-PCR
pPM2R / qPM2R
pPM3 / pPM3F / UPM=5’RACE Material Kit / 67 / 5’RACE
pPM3R1 / ccaggggcagcatatagggcaccatca
pPM3R2 / aggggcagcatatagggcaccatcattg
pPM4 / pPM4F1 / gccctatatgctgcccctggagtctgc / 66-70 / 3’RACE
pPM4F2 / ggtgccctatatgctgcccctggagtct
pPM4F3 / caaccttcgcaacctttaccgcctctca
pPM4F4 / ttgccatagaagcccccccaggagaga
pPM4R / UPM=3’RACE Material Kit
pPM5 / pPM5F / catgctgcctatacgtgt / 65 / Real time
pPM5R / tgcacagtctaagtgtgg
pACTIN / pPM6 / pPM6F / ccccaaagccaacagagaga / 60 / RT-PCR
pPM6R / ccccaaagccaacagagaga
pPM7 / pPM7F / tggcattgctgacaggat / 65 / Real time
pPM7R / ctgcttgctgatccacat
dATGL / dPM1 / dPM8F / qPM2F / 61 / RT-PCR
dPM8R / qPM2R
dPM2 / dPM2F / ctttgaacacctgcctccca / 60 / Real time
dPM2R / gtcatctgctccctcatcca
dACTIN / dPM3 / dPM3F / acgccaacacggtgctg / 63 / Real time
dPM3R / gggtccggattcatcatactc
cATGL / cPM1 / cPM1F / agcagtcggttttcttacacg / 58 / sequencing
cPM1R / gtgcagaagggtcaaatgagg

Note: 1 pATGL, pACTIN, qATGL, qACTIN, dATGL dACTIN, cATGL referred to the parrot ATGL gene, the parrot beta-actin gene, the quail ATGL gene, the quail beta-actin gene, the duck ATGL gene, the duck beta-actin gene and the chicken ATGL gene respectively. AT2 referred to annealing temperature.

Supplementary table 2. Databases of ATGL used for homology analyses

No. / Species1 / Latin / CDs No. / Protein No.
1 / human / Homo sapiens / NM_020376 / NP_065109
2 / mouse / Mus musculus / AY894805 / AAW81963
3 / rat / Rattus norvegicus / NM_001108509 / NP_001101979
4 / pig / Sus scrofa / EU047807 / ABW06598
5 / cattle / Bos taurus / NM_001046005 / NP_001039470
6 / dog / Canis familiaris / XM_849071 / XP_854164
7 / chicken / Gallus gallus / EU852334 / ACF60601
8 / turkey / Meleagris gallopavo / EU852335 / ACF60602
9 / J.quail / Coturnix japonica / EU852336 / ACF60603
10 / opossum / Monodelphis domestica / XM_001380609 / XP_001380646
11 / frog / Xenopus (Silurana) tropicalis / NM_001079227 / NP_001072695
12 / Finch / Taeniopygia guttata / XM_002198284 / XP_002198320
13 / quail / Coturnix japonica / GQ221783 / ACT09361
14 / parrot / Coturnix coturnix / GQ221784 / ACT09362

Note: 1J.quail=Japanese quail; opossum=gray short-tailed opossum; frog=western clawed frog; Finch=zebra finch.

Supplemental table 3. Association of c.777-26C>A with chicken fatness traits

Traits1 / P value / Least squares Mean ± S.E2
AA (39) / AC (14) / CC (266)
BMPH / 0.0221 / 6.28±0.09 a / 5.77±0.16 b / 6.15±0.05 b
CFBM / 0.0379 / 18634.93±989.28 a / 21866.54±1575.11 b / 21100.60±433.61 ab

BMPH=pH value of breast muscle; CFBM=cross-sectional fiber area of breast muscle. Superscripts with the different small letters indicate difference at the level of 0.05. Numbers in bracket refer to sample size for each genotype.

Supplemental table 4. Association of c.950+24C>A with chicken fatness traits

Traits1 / P value / Least squares Mean ± S.E2
AA (140) / AC (32) / CC(151)
CFW / 0.0019 / 11.80±0.41A / 14.18±0.69B / 11.83±0.38B

CFW=cingulated fat width. Superscripts with the different capital letters in the same column indicate significant difference at the level of 0.01. Numbers in bracket refer to sample size for each genotype.

Supplemental table 5. Association of c.950+45C>G with chicken fatness traits

Traits1 / P value / Least squares Mean ± S.E2
CC (184) / CG (58) / GG (82)
CFW / 0.021 / 11.79±0.35 a / 13.36±0.57 b / 11.60±0.56 b
BMPH / 0.0455 / 6.14±0.05 ab / 5.95±0.09 a / 6.25±0.09 b

CFW=cingulated fat width; BMPH=pH value of breast muscle. Superscripts with the different small letters indicate difference at the level of 0.05. Numbers in bracket refer to sample size for each genotype.

Supplemental table 6. Association of c.950+73G>A with chicken fatness traits

Traits1 / P value / Least squares Mean ± S.E2
AA (82) / AG (56) / GG (181)
CFW / 0.0172 / 11.66±0.58 a / 13.45±0.60 b / 11.74±0.36a
CPBM / 0.026 / 24.42±0.30a / 25.13±0.27 b / 25.08±0.21 b

CFW=cingulated fat width; CFBM=cross-sectional fiber area of breast muscle. Superscripts with the different small letters indicate difference at the level of 0.05. Numbers in bracket refer to sample size for each genotype.

Supplemental table 7. Association of c.950+83C>T with chicken fatness traits

Traits1 / P value / Least squares Mean ± S.E2
CC (137) / CT (42) / TT (142)
CFW / 0.0014 / 11.70±0.41AB / 13.98±0.62 A / 11.87±0.42 B

Supplemental table 8. Association of c.950+128delA with chicken fatness traits

Traits1 / P value / Least squares Mean ± S.E2
-/- (131) / -/A (49) / A/A (142)
CFW / 0.003 / 11.81±0.41a / 13.65±0.57B / 11.71±0.38a

Supplemental table 9. Association of c.950+118C>T with chicken fatness traits

Traits1 / P value / Least squares Mean ± S.E2
CC (101) / CT (73) / TT (141)
BMPH / 0.0186 / 6.28±0.07a / 6.03±0.08 b / 6.09±0.06 b
EEBM / 0.0327 / 1.05±0.12a / 0.83±0.12 b / 0.84±0.10b

BMPH=pH value of breast muscle; EEBM=crude fat (ether extract) content of breast muscle. Superscripts with the different small letters indicate difference at the level of 0.05. Numbers in bracket refer to sample size for each genotype.