Supplemental Material for Online Version (S. Remy Et Al.)

Supplemental material for online version (S. Remy et al.).

Materials and Methods.

Animals.

All animal care and protocols were conducted in accordance with the guidelines for animal experiments of the French Veterinary Services and were performed by officially authorized personnel in a certified animal facility.

Design and production of TALE nucleases.

TALE nucleases forRosa26 and Hprt1 locus were designed to recognize the following siteson Rat Mar. 2012 (RGSC 5.0/rn5) genome Assembly.

HPRT1.1 (chrX: 152853039-152853094)

TGTGAGTGGGAAAGTCAATCAACAAGTGAGTAGATAACTGCTAAATCTGTAGTATA

HPRT1.2 (chrX: 152851875-152851926)

TAAGCACTTTTTAAGTGTTTGTTATTCCTAGCAGACAATTTAGGGGAAGGAA

ROSA26 (chr4: 208314007-208314058)

TACAGCCTCGATTTGTGGTGTATGAAACTAATCTGTCTGGTTTCATGAGTCA

For eachTALE nucleasesubunit, the fragment containing the 16 RVD segmentwasobtainedfrom single unit vectors: A (NI), T (NG), G (NN) and C (HD), kindlyprovided by the laboratory of Bo Zhang (Peking University, China). The assembled TALE RVD (HPRT1.1-R:TATACTACAGATTTAGCA;HPRT1.1-L:TGTGAGTGGGAAAGTCAA;HPRT1.2-RTTCCTTCCCCTAAATTGT; HPRT1.2-LTAAGCACTTTTTAAGTG; ROSA26-RTGACTCATGAAACCAGAC; ROSA26-LTACAGCCTCGATTTGTGG) weresubcloned in the pCS2 vectorcontaining the 17th half RVD, N-term, C-term and Fok I catalyticdomains (Miller et al. 2011).

TALE nucleases targeting Ighmlocus were designed and assembled to recognize the exon 2 of the rat Ighmgene, as described (Tesson et al. 2011). Ighm TALE nucleases were designed using the Δ152/+63 N- and C-terminal truncation points (Miller et al. 2011)and FokI catalytic domains(Doyon et al. 2010). Tandem arrays of TALE repeats were assembled by PCR from smaller fragments containing shorter tandem arrays of TALE repeats as described in Miller et al. (Miller et al. 2011).Assembled TALE nucleases DNAs were cloned into the pVAX vector for mRNA production and in a plasmid with the CAG promoter for in vitro cell transfection.

In vitro assay of TALE nucleases.

Each subunit of TALE nuclease plasmid (0.75 and 1.5 µg each) was nucleofected into 4.105 C6 cells (Sigma) in 20µL of V solution using AMAXA FF137 program. Cells were collected 48h after nucleofection and genomic DNA was extracted with E.Z.N.A. Tissue DNA Kit (OMEGA Biotek). The genomic region encompassing the TALE nuclease target sites was amplified with specific primers (Table S2), typically using 50 ng of genomic DNA, and high-fidelity polymerase (Herculase II fusion polymerase –Stratagene, La Jolla, CA) following manufacturer instructions. The PCR products were analysed using the T7 endonuclease I assay (Menoret et al. 2014) followed by electrophoresis to visualize evidence of nuclease cleavage. TALE nucleases for Ighmwere previously tested by Amaxa nucleofection of rat S16 cells with program FF-137 (Tesson et al. 2011).

In vitro transcription of TALE nucleases mRNA

TALE nuclease plasmids were in vitro transcribed to mRNA and polyadenylated using the mMessage mMachine T7 Ultra kit (Ambion, Austin, TX) following the manufacturer protocol and purified using the MegaClear Kit (Ambion, Austin, TX), quantitated using a NanoDrop-1000 (Thermo Scientific) and stored at -80°C until use. mRNAs encoding each monomer of TALE nucleases for each target sequence were mixed in TE 5/0.1 (5mM Tris-Cl pH 7.5, 0.1mM EDTA in RNase DNase free water) and stored at -80°C until use. mRNAs were diluted to the working concentration and kept on ice during one day micro-injection procedures and then discarded.

Targeting vector construction

Plasmids donor sequences were based on the Brown Norway rat genomic sequence (assembly RGSC_3.4). For the Hprt1.1, Hprt1.2 and Rosa26 loci donor sequences containing two 800bp homologous arms separated by a spacer SalI-BamHI (Hprt1/2) or SalI-HindIII (Rosa26) centered between the TALE nucleases target sites, were synthetized by Genecust in a pBluescript II SK+ into XhoI-BamHI sites. In each vector, an expressing cassette containing CAG promoter-eGFP cDNA-BGHpA (3142bp) was cloned at the spacer sites.

For the replacement of rat Ighmexon 2 encoding the IghmCH1 domain, we generated a plasmid containing human IGHMexon 2 flanked by rat sequence 5’ and 3’ homology arms (0.75kb and 1.46kb, respectively).

Donor plasmids were purified using Endofree plasmid maxi kit (Qiagen, France) and quantified on a Nanodrop spectrophotometer. Prior microinjection, donor DNA sequences were separated from the plasmid backbone by BstEII digestion. After electrophoresis, digested linear donor DNA was cut from agarose gel, electroeluted and purified with Elutip-d column (Whatmann, Dassel, Germany). Excised linear DNA was quantified using a NanoDrop-1000 and stored at -20°C until use. Linear donor DNA or supercoiled plasmid DNA were mixed with TALE nucleases mRNA and stored at -80°C until use.

Microinjection of rat one-cell embryos.

Prepubescent females (4-5 weeks old) were super-ovulated with pregnant mare serum gonadotropin (30IU; Intervet, France) and followed 48 hours later with human chorionic gonadotropin (20IU; Intervet, France) before breeding. Fertilized 1-cell stage embryos were collected for subsequent microinjection using a previously published procedure (Geurts et al. 2010; Tesson et al. 2011). Briefly, a mixture of TALE nucleases mRNA and donor DNA was microinjected sequentially into the male pronucleus and into the cytoplasm of fertilized one-cell stage embryos. Different ratios of diluted TALE nucleases mRNA and donor DNA have been tested. Microinjected embryos were maintained under 5% CO2 at 37°C 3h, 37°C 1h followed 30°C 2h, or 30°C 3h. Surviving embryos were then implanted immediately in the oviduct of pseudo-pregnant females (0.5dpc) and allowed to develop until embryonic day 15 or to full term.

Analysis of targeted and RI of DNA donor sequences.

DNA from embryos or neonates was extracted from tail biopsy following treatment with Proteinase K as previously described in (Tesson et al. 2010). To analyze donor DNA integration, we amplified DNA using the primer pairs GFP Up and GFP Lo3. Each GFP positive rat was PCR amplified with in-out primers (HPRT1.1or HPRT1.2 or ROSA26 -5outFor-5CAGpRev for the 5’ side and BGHpAUp2-HPRT1.1 or HPRT1.2 or ROSA26 -3outRev for the 3’ side) (Table S2). Southern-blots were also made on genomic DNA digested by EcoRI for Hprt1.1, BamHI for Hprt1.2 and EcoRI for Rosa26. After digestion, the DNA was separated by agarose gel electrophoresis, transferred to a nylon membrane (Hybond XL ,GE Healthcare), hybridized with a DNA probe labeled with 32P-dCTP, washed and subjected to autoradiography.

Analysis of GFP expression.

Native GFP expression was monitored in E15 fetuses and pups using a Dark Reader® Spot Lamp (Clare Chemical Research, Inc.). To analyze the level of GFP expression in cells and tissues of adult Rosa26 knock-in rats, FACS analysis were performed on leucocytes isolated from whole blood cells and stained with an APC-conjugated mouse anti-rat CD45 antibodies (OX1+OX30), and fluorescent tissue sections were examined using a Zeiss microscope (Thomwood, NY), and images were captured with a digital camera (Axio-CamHRC, Zeiss) driven by AxioVision Release 4.2software.

Analysis of IghmmRNA.

Total RNA was isolated from white blood cells by the Trizol method according to the manufacturer's instructions (Life Technologies). DNase treatment was done on total RNA by TurboDNAfree (Ambion). Two ug of total RNA were reverse transcribed at 42°C with MMLV-RT (Life Technologies). PCR reactions were set up using rat HPRT Up2-Lo2 (endogenous gene control) and 5CH1huUp-rCH1Ex6Lo (specific KI transcripts) primers (Table S2). Target transcripts were amplified with Herculase II (Stratagene) under following conditions : 5' at 94°C - 2' at 62°C - 35 cycles of 1' at 72°C - 30" at 94°C - 30" at 60°C and the reaction finished with 3' at 72°C and storage at 4°C. PCR products were separated on 1% agarose gel.

Supplementary tables

Table S1. Germline transmission

Table S2. Primer sequences

Primer name / 5’-3’ Sequence
NHEJ detection
rHPRT1.1fw1
rHPRT1.1rev1
rHPRT1.2fw1
rHPRT1.2rev1
rROSAfw1
rROSArev1
GJC 153F
GJC 154R
/ CCCCACCTCACAACCTTGCT
CAAGGGTTCTTTCCCTAAAATGGA
TGGCTGCTTTTAAGCTTTGAGA
TCATTGTTCTTCCAGAGGACCTG
TGAACTGTGAATAGGCCCAAGTG
GCATTTTAAAAGAGCCCAGTACTTCA
GGAGGCAAGAAGATGGATTC
GAATCGGCACATGCAGATCT
Donor insertion
GFP Up
GFP Lo3
huCH1Ex2Up
huCH1Ex2Lo / CCTCGTGACCACCCTGACCT
TCCATGCCGAGAGTGATCCC
CATCCGCCCCAACCCTTTTC
GAGGCACGTTCTTTTCTTTGTTG
In/out PCR
rHPRT1.1-5outFor
rHPRT1.1-3outRev
rHPRT1.2-5outFor
rHPRT1.2-3outRev
rROSA26-5outFor
rROSA26-3outRev
5CAGpRev
3BGHpA-Up2
rSacIUp3
humuCH1R
5CH1huUp2
rKpnILo3 / CCTCAGTCCCAGCGTCGT
TCCTTGCTTCTGGTGCTGGT
TGTTCTACTAGGTAAGCAAGTTCTCT
ACATGGAAGGCAGAAGGATTAGTTT
TCCCACCCTCCCCTTCCTCT
TGGGTATCACTGGCTGTCCTAGATA
GGCTATGAACTAATGACCCCGTAAT
CCAGATTTTTCCTCCTCTCCTG
gctaggatgagttgagttggct
ACGCTGCTCGTATCCGACG
TTCCTTCCCGACTCCATCACTT
ccatcggggctgttagactgagaat
Ighm mRNA detection
5CH1huUp
rCH1Ex6Lo
rHPRTUp2
rHPRTLo2 / CAACTCTGACATCAGCAGCACCC
TGGTCCATAGGTTCTCAAAGCCT
CCTTGGTCAAGCAGTACAGCC
TTCGCTGATGACACAAACATGA

Primers are listed for NHEJ detection, donor insertion, in-out PCR and Ighm mRNA detection.

Figure S1. Targeted integration of a GFP cassette into Hprt1.1 locus with Hprt1.1TALE nuclease

(A, upper) Diagram showing schematic representation of the rat Hprt1.1locus, with the site of TALE nuclease action (vertical arrows), and of the targeting vector with the expression cassette (3142 bp) and the 5’ and 3’ homology arms (800 bp each). The homology arms are contiguous to the TALE nucleases cleavage point. Colored in grey, the sequence overlap (433 bp) between 3’HArHPRT1.1and 5’HArHPRT1.2 (cf figure 2). BstEII restriction sites are indicated. (A, lower) Diagram showing schematic representation of the GFP cassette integration. For flanking PCR analysis, genomic DNA were PCR amplified with primers situated for the 5’ side: upstream of the 5’HA arm (HPRT1.1-5outFor) and in the CAG promoter (5CAGpRev), and for the 3’ side: in the BGHpA (3BGHpA-Up2) and downstream the 3’ HA arm (HPRT1.1-3out Rev). The position of each primer and the corresponding expected size of PCR products are indicated on the schematic knock-in Hprt1.1locus. (B) FlankingPCR analysis. Gels show the results analyzing the 5’ and the 3’extremities of GFP integration intoHprt1.1locus. A representative panel of two animals is illustrated, showing expected bands of 1046 bp using the 5’ of primers (HPRT1.1-5outFor + 5CAGpRev) and of 974 bp using the 3’of primers (3BGHpA-Up2 + HPRT1.1-3outRev). NTC, no template control.

Figure S2. PCR analysis of configuration of transgene concatemers

(A) Diagram showing schematic representation of analysis of the different potential concatemer configurations for Hprt1 and Rosa26 loci. Genomic DNA was PCR amplified with primers(3BGHpA-Up2 and 5CAGpRev) at positions indicated on the schematic. Expected sizes of amplicons are indicated below. (B) Gels show the results obtained for head-to-tail concatemer analysis. PCRs for the other concatemer configurations were negative and are not shown. (C) Diagram showing schematic representation of analysis of the head-to-tail potential concatemer configurations for theIghmlocus. Genomic DNA was PCR amplified with primers(huCH1Lo and 5CH1hU). Expected size of amplicons is indicated below. (D) Gel shows the results obtained for head-to-tail concatemers.

Doyon Y, Choi VM, Xia DF, Vo TD, Gregory PD, Holmes MC. 2010. Transient cold shock enhances zinc-finger nuclease-mediated gene disruption. Nat Methods 7(6): 459-460.

Geurts AM, Cost GJ, Remy S, Cui X, Tesson L, Usal C, Menoret S, Jacob HJ, Anegon I, Buelow R. 2010. Generation of gene-specific mutated rats using zinc-finger nucleases. Methods Mol Biol 597: 211-225.

Menoret S, Tesson L, Remy S, Usal C, Thepenier V, Thinard R, Ouisse LH, De Cian A, Giovannangeli C, Concordet JP et al. 2014. Gene targeting in rats using transcription activator-like effector nucleases. Methods.

Miller JC, Tan S, Qiao G, Barlow KA, Wang J, Xia DF, Meng X, Paschon DE, Leung E, Hinkley SJ et al. 2011. A TALE nuclease architecture for efficient genome editing. Nat Biotechnol 29(2): 143-148.

Tesson L, Remy S, Menoret S, Usal C, Anegon I. 2010. Analysis by quantitative PCR of zygosity in genetically modified organisms. Methods Mol Biol 597: 277-285.

Tesson L, Usal C, Menoret S, Leung E, Niles BJ, Remy S, Santiago Y, Vincent AI, Meng X, Zhang L et al. 2011. Knockout rats generated by embryo microinjection of TALENs. Nat Biotechnol 29(8): 695-696.