Supplemental Data
Figure Legends
Fig. S1 Cell growth in the medium with BSA as the major nitrogen source by counting of colony forming unit. The conditions for cell growth were same as that described in Fig. 1A and Materials and Methods. After cell growth in YCB-BSA-YE (0.01%) for 12, 24 and 48 hours, the numbers of colony forming unit were counted. A representative result from at least three independent experiments with identical results is shown.
Fig. S2 Cell growth in YCB-BSA-0.05% YE. 0.05% YE largely rescued the growth delay of RHB1-overexpressed and sap2-deleted strains. Cells were grown in YPD broth overnight, washed twice with sterile water, and subcultured in YCB-BSA-YE (0.05%) medium (initial cell density, O.D.600 = 0.5) at 30°C. C. albicans strains used in this experiment were SC5314: wild type (filled triangles); CCT-D1: rhb1-deleted (open squares); CCT-RD1: RHB1-reconstituted (open circles); CCT-OE1: RHB1 overexpressed (filled circles); SAP2MS4A: sap2-deleted (filled squares).
Fig. S3 Western blot analysis of BSA degradation. The small-molecular-weight proteins were derived from degradation of BSA in the medium. Wild type (SC5314) cell was grown in YCB-BSA-YE (0.01%) medium as described in Fig. 1A. 20µl of supernatant collected at the indicated time was analyzed by 12% SDS-PAGE as described in Fig. 1B. 20µl of YCB-BSA-YE (0.01%) medium or BSA (0.1%) alone were loaded as the control. Proteins were visualized by Coomassie blue staining and western blotting using BSA polyclonal antibody.
Fig. S4 Intracellular Sap2 protein level induced by rapamycin was not controlled by the tetracycline-inducible promoter. The TetGFP-1 strain carrying tetracycline-inducible GFP was first grown to O.D.600 = 2.5–3 in YCB-BSA-YE (0.01%) medium containing 30 µg/ml doxycycline at 30°C for 6 h (as described in Fig. 4A). The cultures were then equally divided into tubes containing 0.2 µg/ml rapamycin or 0.2% methanol (MeOH; the vehicle control). The cells were incubated and harvested at the indicated time. Whole cell extract (20µg) from each sample was analyzed with SDS-PAGE and immunoblotted using monoclonal anti-GFP. The nonspecific band was used as the loading control.
Fig. S5 The ADH1 promoter can induce Rhb1 protein overexpression. 50µg and 100 µg of whole cell lysates extracted from the strains carrying Rhb1-6HisFLAG (PRHB1) and OE-Rhb1-6HisFLAG (PADH1) were analyzed by 12% SDS-PAGE and immunoblotted using monoclonal anti-6His. The nonspecific band was used as the loading control.
Table S1. Genes upregulated in the rhb1 mutant as shown by microarray analysis (P ≤ 0.0148 and fold change ≥ 1.5)
Gene namea Descriptionb Assembly 21 orfc Fold change
GAP2 Amino acid permease orf19.6993 4.998
– Best hit ScYPL113C is a glyoxylate reductase orf19.1473 4.000
MEP2 Ammonium permease orf19.5672 3.110
– Ortholog Cd36_31810 is a putative n-acetyl transferase orf19.3885 2.744
ARO10 Aromatic decarboxylase orf19.1847 2.682
ARG1 Putative argininosuccinate synthase orf19.7469 2.641
CPA1 Putative carbamoyl-phosphate synthase subunit orf19.4630 2.470
ARG4 Argininosuccinate lyase orf19.6689 2.259
OPT9 Oligopeptide transporter gene orf19.2584 2.153
HHF22 Putative histone H4 orf19.1854 2.055
CIP1 Similar to plant isoflavone reductase orf19.113 1.963
HTB2 Putative histone H2B orf19.1052 1.916
ARG5,6 Arginine biosynthetic enzyme activities orf19.4788 1.894
TNA1 Putative nicotinic acid transporter orf19.4335 1.866
– Unknown orf19.4886 1.849
WH11 Cytoplasmic protein expressed specifically in white phase yeast- orf19.3548.1 1.841
form cells
HHF1 Putative histone H4 orf19.1059 1.764
– Unknown orf19.3448 1.651
SPE1 Ornithine decarboxylase orf19.6032 1.639
HTA2 Putative histone H2A orf19.1051 1.598
RBT1 Cell wall protein with similarity to Hwp1p orf19.3384 1.594
DUR31 Major urea transporter orf19.781 1.589
NCE103 Carbonic anhydrase orf19.1721 1.586
HTA1 Putative histone H2A orf19.6924 1.581
– Unknown orf19.94 1.565
– Best hit ScPmp3 is a small plasma membrane protein orf19.2959.1 1.565
– Unknown orf19.6754 1.565
ECM42 Putative ornithine acetyltransferase orf19.6500 1.562
Table S1. cont.,
Gene namea Descriptionb Assembly 21 orfc Fold change
– Ortholog ScUps2 has role in phosphatidylethanolamine metabolic orf19.3089 1.546
process
ALS3 Cell wall adhesin orf19.2355 1.539
AAT22 Best hit ScAat22 is a cytosolic aspartate aminotransferase orf19.4669 1.533
SAP2 Major secreted aspartyl protease orf19.3708 1.533
– Ortholog Cd36_23250 is a putative acyltransferase orf19.406 1.523
DAL9 Putative allantoate permease orf19.696 1.522
FAA21 Predicted acyl CoA synthetase orf19.272 1.518
– Ortholog ScYop1 has role in vesicle-mediated transport orf19.2168.3 1.500
aGene names refer to those in the Candida genome database (CGD, http://www.candidagenome.org/).
bDescription as assigned in CGD, except the best hit or ortholog gene of S. cerevisiae and C. dubliniensis is as annotated in SGD (http://www.yeastgenome.org/) and Candida dubliniensis GeneDB (http://old.genedb.org/genedb/cdubliniensis/), respectively. Sc indicates homology with S. cerevisiae; Cd indicates homology with Candida dubliniensis.
cORF number is from assembly 21 in CGD.
Table S2. Genes downregulated in the rhb1 mutant as shown by microarray analysis (P ≤ 0.0148 and fold change ≥ 1.5)
Gene namea Descriptionb Assembly 21 orfc Fold change
HIP1 Putative general amino acid permease orf19.3195 5.389
GAP1 General amino acid permease orf19.4304 3.298
GCV2 Putative protein of glycine catabolism orf19.385 3.057
CAR1 Predicted arginase orf19.3934 2.899
CAR2 Predicted ornithine-oxo-acid transaminase orf19.5641 2.774
DUR1,2 Urea amidolyase orf19.780 2.694
CHA1 Protein similar to serine/threonine dehydratases orf19.1996 2.623
ADE5,7 Enzyme of adenine biosynthesis orf19.5061 1.954
AFP99 Protein described as related to arginases orf19.5862 1.943
– Transposable element gene orf19.6079 1.874
RPL5 Predicted ribosomal protein orf19.6541 1.866
ADE13 Enzyme of adenine biosynthesis orf19.3870 1.842
– Ortholog ScDsk2 is nuclear-enriched ubiquitin-like polyubiquitin- orf19.5345 1.833
binding protein
MIS11 Similar to precursor of mitochondrial C1-tetrahydrofolate synthase orf19.2364 1.824
HEM13 Coproporphyrinogen III oxidase orf19.2803 1.812
– Ortholog Cd36_45830 is a putative argonaute protein involved in orf19.2903 1.807
RNA silencing
YST1 Ribosome-associated protein orf19.6975 1.774
– Ortholog ScCir2 is a putative ortholog of human electron transfer orf19.3175 1.764
flavoprotein dehydrogenase
HGT18 Putative glucose transporter orf19.2425 1.753
SHM2 Cytoplasmic serine hydroxymethyltransferase orf19.5750 1.733
– Unknown orf19.6113 1.726
MET6 Essential 5-methyltetrahydropteroyltriglutamate-homocysteine orf19.2551 1.716
methyltransferase
ZCF3 Predicted zinc-finger protein of unknown function orf19.1168 1.714
– Unknown orf19.2701 1.711
SSB1 Putative HSP70 family heat shock protein orf19.6367 1.694
Table S2. cont.
Gene namea Descriptionb Assembly 21 orfc Fold change
SPT5 Putative transcription elongation factor orf19.1453 1.691
– Ortholog ScPkh1 is a serine/threonine protein kinase orf19.5224 1.691
RPL8B Predicted ribosomal protein orf19.6002 1.690
– Best hit ScMet1 is a S-adenosyl-l-methionine uroporphyrinogen orf19.5842 1.680
III transmethylase
RPO21 RNA polymerase II orf19.7655 1.680
YAK1 Predicted serine/threonine protein kinase orf19.147 1.676
PAN1 Subunit of actin cytoskeleton regulatory complex orf19.886 1.662
– Unknown orf19.2866 1.657
ERG1 Squalene epoxidase orf19.406 1.642
ACT1 Actin orf19.5007 1.628
SGT1 Putative co-chaperone protein in kinetochore assembly orf19.4089 1.625
ADE2 Phosphoribosylaminoimadazole carboxylase orf19.5906 1.622
– Ortholog ScYBR074W is a putative metalloprotease orf19.2163 1.614
MVD Mevalonate diphosphate decarboxylase orf19.6105 1.600
– Best hit ScBna3 is a kynurenine aminotransferase orf19.7522 1.594
PRO3 Protein induced during the mating process orf19.5650 1.591
MSN5 Ortholog ScMsn5 function as importin-alpha export receptor orf19.2665 1.588
activity
– Best hit ScGAP1 is a general amino acid permease orf19.1799 1.585
RPL6 Putative ribosomal protein orf19.3003.1 1.572
– Ortholog ScMet12 has NADPH reductase activity orf19.5321 1.571
– Best hit ScYBR235W is a putative ion transporter orf19.6832 1.568
HYU1 Hydantoin utilization protein A orf19.5804 1.567
PHB1 Putative prohibitin orf19.6944 1.566
GCR3 Ortholog ScGcr3 is a large subunit of the nuclear mRNA cap- orf19.387 1.564
Protein complex
RPS4A Predicted ribosomal protein orf19.5341 1.564
OYE23 Putative NADPH dehydrogenase orf19.3433 1.563
Table S2. cont.
Gene namea Descriptionb Assembly 21 orfc Fold change
IMH3 Inosine monophosphate dehydrogenase orf19.18 1.563
EFG1 Transcriptional repressor orf19.610 1.563
– Ortholog ScPhb1 is a subunit of the prohibitin complex orf19.357 1.562
– Putative member of a family encoded by FGR6-related genes in the orf19.6896 1.562
RB2 repeat sequence
SAH1 S-adenosyl-l-homocysteine hydrolase orf19.3911 1.561
– Best hit ScSlm1 is a phosphoinositide PI4,5P(2) binding protein orf19.4043 1.560
– Ortholog ScTfa2 is a TFIIE small subunit orf19.4882 1.557
– Ortholog ScYGR111W has a role in cell size regulation orf19.1272 1.550
– Unknown orf19.5177 1.550
POL3 Large subunit of DNA polymerase III orf19.5182 1.542
TEF1 Translation elongation factor 1-alpha orf19.1435 1.537
– Ortholog ScTes1 is a peroxisomal acyl-CoA thioesterase orf19.4122 1.536
– Ortholog ScSam50 is a component of sorting and assembly orf19.7358 1.535
machinery of the mitochondrial outer membrane
OLE1 Fatty acid desaturase orf19.5117 1.534
PEP3 Peptidase orf19.5584 1.526
– Ortholog ScEsl2 is a putative ribosome-associated protein orf19.4686 1.523
– Ortholog ScTcb1 is a lipid binding protein orf19.1840 1.519
ARE2 Acyl CoA:sterol acyltransferase orf19.2248 1.513
– Unknown orf19.7272 1.508
– Best hit ScSad1 is a conserved zinc-finger domain protein orf19.7265 1.508
CRK1 Protein kinase of the Cdc2 kinase subfamily orf19.3523 1.507
– Unknown orf19.2779 1.504
aGene names refer to those in the Candida genome database (CGD, http://www.candidagenome.org/).
bDescription as assigned in CGD, except the best hit or ortholog gene of S. cerevisiae and C. dubliniensis is as annotated in SGD (http://www.yeastgenome.org/) and Candida dubliniensis GeneDB (http://old.genedb.org/genedb/cdubliniensis/), respectively. Sc indicates homology with S. cerevisiae; Cd indicates homology with Candida dubliniensis
cORF number is from assembly 21 in CGD.
Table S3. Primers used in this study
Primer name Sequence (5′ to 3′)
STP1 deletion
CaSTP1-5′-1 ATCGGGTACCGCGCTGTTGTCTTCCTGAa
CaSTP1-5′-2 ATCGGGGCCCACCGAAAATTTTGCGTTGAA
CaSTP1-3′-1 ATCGCCGCGGGGGTTTTCGGTTATTATTTC
CaSTP1-3′-2 ATCGGAGCTCTGGTCTTGCAGGAAGAAAAG
One-hybrid assay strain construction
CaGAT1-5′ GGTCCACGCGTGGTGGAGGTCCAGGTGGAATGTACTACCGTGCTCGTCAC CaGAT1-3′ GCCCGCCTGCAGCTAATAATTCATGTTTAACCAATCCCAA
CaSTP1-5′-3 ATCGAAGCTTATTAAAATGTTGATACTTTCCATAGGT
CaSTP1-3′-3 ATCGACGCGTACCACCACCATCTAGTAATAGATTGCTTACATTC
LexA-MluI-F GGTCCACGCGTGGTGGAGGTCCAGGTGGAATGAGAGAATTAA
LexA-PstI-R GCCCGCCTGCAGTTACATTTCGCGGTACAAACCAATTAC
RT-PCR
CaSAP2-1 TGATTGTCAAGTCACTTATAGT
CaSAP2-2 CTTAGGTCAAGGCAGAAATACTG
EFB1-1 ATTGAACGAATTCTTGGCTGAC
EFB1-2 CATCTTCTTCAACAGCAGCTTG
Real-time quantitative PCR
GAP1
CaGAP1q1 GCTGAACAAGGAATGGCACC
CaGAP1q2 GCAAATAATGGTCTTCCGGCT
GAP2
CaGAP2q1 TGCCTTTGCTTTCGCTGGTA
CaGAP2q2 TTGGGTTTTCGGTTTCAGCA
HIP1
CaHIP1q1 GGACAGCATTGTTCCCCTTG
CaHIP1q2 GTTTTCGGCATGGCCTTTACC
EFB1
Q-EFB1F1 TAAGAAGGCTGCTAAAGGTCCAA
Q-EFB1R2 ATCCCATGGTTTGACATCCAA
aUnderlined nucleotides indicate a restriction enzyme site