Suppl. Figure 1: Host Plant Determination Using Phylogenetic Analyses

Suppl. Figure 1: Host plant determination using phylogenetic analyses.

Nuclear ribosomal internal transcribed spacer sequences (ITS, a) or an intergenic region of plastid sequences (psbA, b, c) were used to determine the plant sample RCA 21 (a, b) or RCA 22 (c). The most closely related sequences were retrieved from databases (February 2012) and redundant distantly related entries deleted. For comparison, samples of Nicotiana benthamiana Domin, Malva parviflora L., Abutilon megapotamicum (Spreng.; A. St.- Hil. & Naudin), and Peristrophe speciosa Roxb. ex Wall. (kindly provided by the Botanical Garden Potsdam) were processed in parallel to samples RCA 21 and RCA 22 using the PCR primer pairs psbA (GTTATGCATGAACGTAATGCTC) and trnHf (CGCGCATGGTGGATTCACAATCC) for the plastidal sequence or ITS5a (CCTTATCATTTAGAGGAAGGAG) and ITS4 (TCCTCCGCTTATTGATATGC) for the nuclear sequence, respectively, as described for plant barcoding [8]. The resulting PCR fragments were sequenced directly using the same primers. No ITS fragment was obtained for RCA 22 and Peristrophe speciosa in repeated independent experiments, whereas the other samples yielded the expected fragment sizes. The sequence of N. benthamiana was taken as outgroup, the Neighbor Joining tree was determined with 1000 replicates, bootstrap values above 500 are indicated at the nodes.

Suppl. Figure 2: RCA/RFLP analysis of DNAs A using stained gels

Close-up of Fig. 1 with the stained agarose gel in inverted grey scale. Calculated (observed) fragment sizes (white) were determined from the DNA migration in the gel with reference to several standards (not shown, except for AbMV, A) using the probit transformation for the x axis and the logarithm for the y axis as described previously [2]. Predicted fragment sizes for CCGG cleavage (grey letters) and GATC cleavage (black letters) are shown for the contig sequences and the cloned DNA. In Microsoft Powerpoint, the large double arrows can be used to facilitate the alignment of the predicted and the observed values, and the grouped numbers can be transferred into the background to judge the band intensities.

Suppl. Figure 3: RCA/RFLP analysis of DNAs B using stained gels.

As in Suppl. Fig. 2, but with the predicted fragments of DNAs B.

Suppl. Figure 4: RCA/RFLP analysis of DNAs A using hybridization.

As in Suppl. Fig. 2, but with the predicted fragments of hybridised DNA A.

Suppl. Figure 4: RCA/RFLP analysis of DNAs B using hybridization.

As in Suppl. Fig. 2, but with the predicted fragments of hybridised DNA B.