Name: ______
Stem Cells, Cell Cycle, Cancer, Protein Synthesis – Review Topics Honors
- Know why cells divide instead of growing: 2 reasons
- What is a diploid cell?
- How do you calculate the diploid number of a cell?
- What are homologous chromosomes?
- Know the events of the cell cycle – Interphase (G1, S phase, G2) and M-phase (Mitosis) and (Cytokinesis)
- Be able to define Mitosis and Cytokinesis
- Know what forms between an animal cell and a plant cell during Cytokinesis (cleavage furrow(animal cells) and cell plate (plant cells))
- Know what cyclin is and what it does.
Cell Cycle
Matching: Match the correct letter with the correct description. Words are used only once. (1-9)
______1. Uncontrolled cell growth of abnormal cells
______2. A fast growing tumor that spreads to other parts of
the body.
______3. A series of events a cell goes through as it grows and
divides.
______4. Cell that contains two sets of DNA. One set from
mom and the other set from dad.
______5. Division of the nucleus
______6. A slow growing tumor that does not spread to other
parts of the body.
______7. Division of the cytoplasm
______8. Part of the cell cycle where the cell grows and the
DNA replicates.
______9. Proteins that supervise the cell cycle.
Short Answer:
- When does a cell begin making a new cell?
- What is the role of cyclin within a normal cell?
- Describe how a tumor forms.
- How is a malignant tumor different from a benign tumor? Use the word metastasizes in your answer.
- What are homologous chromosomes?
- A human somatic cell contained 46 pieces of DNA, how many pieces of DNA will be found in the cell after Interphase?
- A human somatic cell contained 46 pieces of DNA, how many pieces of DNA will be found in the new daughter cells at the end of Mitosis?
- A human somatic cell is said to be 2N. What does the 2 and the (N) stand for?
- AnAvatar somatic cell has an N value of 26, what is its diploid number for the Avatar’s cell?
- If you know that the diploid number for a cell is 64, how many pieces of DNA did mom contribute to this cell?
- What are the two parts of the cell cycle?
- What is mitosis?
- What is cytokinesis?
- Why do plant cells have a different method for performing cytokinesis? Explain.
- What are two reasons why cells divide instead of continually growing?
- Complete the graphic organizer below for a made up cell:
Protein Synthesis –
Use the following DNA sequence to answer the questions that follow:
TACGCCGTAAATCGTGGTAACGCCATC
- What will be the mRNA that results from transcription?
- If the underlined portions represent introns, what will the mature mRNA be/read?
- How many codons does this mature mRNA have? How many tRNA anticodons will there be?
- What anticodons will the tRNAs have for this mRNA?
- What amino acids will make up the polypeptide?
If a mutation occurred and the DNA became:
TACGCCGTAAATCGAGGTAACGCCATC
- What type of mutation is this?
- How will the protein be affected (be specific).
Understand how the process of protein synthesis works:
- Transcription: GOAL?
- where does it occur?
- What are roles of transcription factors like activators or repressors?
- What is a promoter region? What is a TATA box?
- What is the role of RNA polymerase in this process?
- How is mRNA made?
- When does RNA polymerase know to stop transcription?
- What is pre-mRNA?
- How do spliceosomes make pre-mRNA into mRNA?
- Where does the mRNA go from here?
- Translation: GOAL?
- Where?
- Role of ribosome? tRNA? rRNA?
- What is a codon?
- What is the start codon?
- What are the stop codons?
- What could happen if one letter of the DNA was to change (mutate). Explain the possibilities.
- How do proteins generate traits?
- How many different amino acids are there, and what is their role in translation?
- Where did the amino acids floating in your cells’ cytoplasm come from?
- Stem cells:
a. what are they?
b. why are they controversial?
c. what is stem cell differentiation?
d. How could stem cells help to treat diseases?
