Review on Mendel and Transmission Genetics

What was Mendel's explanation for why some traits seem to skip generations?
One of Mendel’s experiments was a monohybrid cross between plants with wrinkled peas and plants with round peas. Outline a monohybrid cross with these plants. Assuming the round phenotype is dominant, what results do you expect in the F1 and F2 generations?
What is a testcross and why would a scientist use it?
In humansachondroplasia type dwarfism phenotype is dominant. Explain how it possible for two healthy people to have a child with dwarfism. (Hint this involves the source of new genetic variation.)
In Labrador retrievers, black fur is dominant to chocolate fur. What are the possible genotypes of a dog with chocolate fur; what are the possible genotypes of a dog with black fur?
Suppose you got a stray black Labrador retriever at the SPCA whose parents were unknown. Design an experiment to determine the genotype of this dog.
What are the possible results from the experiment you designed in question 6 and what conclusion would you draw from each type of result.
Explain why it is unnecessary to testcross individuals with the recessive phenotype.
Suppose Mendel cross a truebreeding strain of tall pea plants with purple flowers with a strain that was dwarf with white flowers. In the F1 generation all the plants were tall with purple flowers. What phenotypic ration would you expect in the second generation (F2 generation).
Suppose in the experiment outline in question 9, you got a 3:1 ratio of tall purple flowered plants to dwarf white flowered plants. What would you conclude?
The attached earlobe trait is recessive to the detached earlobe trait. A couple both with detached earlobes has a son with attached earlobes. What is the probability the next child will have attached earlobes?
The classic example of partial dominance in plants is in flower color of four o’clocks plants. A mating of red flowered and white flowered four o’clocks produced plants with pink flowers. What would the F1 plants look like if this trait showed codominance?
What phenotypic ration would you expect if you crossed a pink flowered four o-clocks plant with a white flowered four o-clocks plant?
Why is familiar hypercholesterolemia an example of incomplete dominance in humans?
Explain how it be possible for a women with type A blood and a man with type B blood to have a child with type O blood.
Assuming the couple described in question 4 had a second child. What is the likely hood the next child will have type AB blood?
Why is sickle cell anemia described as displaying pleiotrophy?
What protein does the familial hypercholesterolemia gene encode?
Would it be possible for two people with healthy levels of cholesterol to have a child with familial hypercholesterolemia? Explain your answer.
Why can skin color in humans be described as a multifactorial trait?
Albinism in mice (White fur and pink eyes) is a recessive trait. A mouse with grey fur was trapped in the new science building. Explain how a test cross could be used to determine the genotype of this mouse for the albino gene.
Milk productions in cows is an example of a multifactorial trait. A farmer bought the same breed of Jersey milk cows as his neighbor, but always got less milk/cow compared to his neighbor. What might be the multifactorial explanation for his poor milk production?
The blending theory of heredity predicts that human children will have a level of skin pigmentation somewhere in between their mother and father. However, in this polygenic trait children can often have skin pigmentation darker or lighter than their parents. What is the explanation for this phenomena?
Colorblindness is a recessive X linked trait. If a colorblind woman has children with a non-colorblind man what would you expect the children to be colorblind or have normal vision?
In fruit flies a single gene controls leg length. The allele for long legs is dominant to the recessive allele for short legs. This trait is sex linked. Suppose you mated a long legged male fly with a short legged female fly. What ratio of phenotypes would you expect in the offspring?
Czar Nicholas and Czarina Alexandra’s first son, Alexis, had hemophilia. What are the genotypes of the Czar and Czarina?
What were the possible genotypes of Czar Nicholas’s daughter the Grand Duchess Anastasia for the hemophilia gene?
Consider the pedigree below for a rare genetic disease. Is this disease dominant or recessive? Explain your answer.

Using the letter “A” for the dominant allele and the letter “a” for the recessive allele? What would be the genotypes of the two original parents?

Review on DNA

How are the four nucleotides that make up DNA similar and how do they differ?
In the 1920’s why did most scientists think that genes were most likely made of protein?
What did Fredrick Griffith demonstrate about the nature of genes?
How would Avery’s results have differed if protein had been the genetic material?
Suppose that Avery treated heat killed smooth bacteria with RNAse and mixed this treated sample with living rough bacteria. When he injected this mixture into the mouse, the mouse died. What did Avery conclude from these results?
What did Rosalind Franklin’s experiment with X-ray diffraction of DNA demonstrate?
What was Watson and Crick’s major contribution to the structure of DNA?
What determines the order of nucleotides linked together by DNA polymerase?
Eukaryotes like humans and pea plants have multiple origins of replication but bacteria like E. coli have a single origin of replication. Explain why eukaryotes need multiple origins of replication and bacteria do not.
What are the two parts of the central dogma of molecular biology?
What would be the sequence of amino acids in the polypeptide encoded by the following mRNA?

GGCGAUCGCCGACAGGUCUCGAAUGGCAUCCGGUACAUCCUAACGGCUGGUGUCGAAACAGUCAAUCGGCU

In animals only about 25% of the genome is transcribed by RNA polymerase. What determines which regions are transcribed and which are not transcribed?
Name a type of RNA that doesn’t include an open reading frame in its sequence.
What triggers transcriptional termination and what happens to the RNA polymerase during transcriptional termination?
What happens during transcriptional initiation?
At the end of translational initiation, what are in the A and P sites of the ribosome?
During translation elongation, what are in the A and P sites immediately after translational translocation?
After which stage of translation would you expect to find a tRNA in the P site without an amino acid attached to it?
Of the three stages of translational elongation, which stage occurs immediately prior to translational termination.
After translational termination, what components are recycled and can reengage in another round of translation.
Explain why a non-sense mutation would be expected to have a bigger effect on phenotype than a mis-sense mutation.
Explain how a base substitution could result in a silent mutation.
Explain why there cannot be a silent mutation in a tryptophan codon.
What physically prevents transcription of the lac operon in the absence of lactose?
Under what environmental conditions would you expect the lac repressor to be bound to the lac operator?
If you had a mutant E. coli cell that lacked the lac repressor, how would expression of the lac operon change?
What is meant by the term “differential gene expression” in humans?
Why would the hemoglobin gene be described as a luxury gene and not a house keeping gene?
Would the eyeless gene best be described as a luxury gene or a housekeeping gene?
What happens if the eyeless gene is absent in fruit flies?
What happens if the eyeless gene is expressed in every cell of a fruitfly?
What gene is responsible for making sure the eyeless gene is only expressed in the head of fruitflies?
What is the SRY gene and where would you find it?
Explain why a mutation in the SRY gene could result in a XY individual having a female phenotype?
What protein does the gene for testicular feminization encode?
What would be the phenotype of an XX individual with a mutation in the gene for testicular feminization?
Contrast the phenotypes of XY individuals with a mutation in the SRY gene and XY individuals with mutations in the testicular feminization gene.
Suppose a mutation in a gene altered the mRNA sequence by changing the single nucleotide circled below from a C to an A.

ACGUUGUAUGCGGUACUCCUGACGA

ACGUUGUAUGCGGUAAUCCUGACGA

What class of mutation would this be (missense, nonsense or silent)?How would this mutation affect the structure of protein encoded by this gene?

Review on Biotechnology

BIO 100 Exam IV review guide

The transgene in BT corn encodes the BT toxin. What is the original source of this gene?
How does expressing the BT toxin transgene in corn “improve” the corn?
Before the BT gene was introduced into the chromosomes, it had to be modified so that it had a plant promoter attached to the BT toxin open reading frame. Why was it important to attach a plant promoter to the gene?
BT corn is extremely popular with farmers. Approximately 90% of all corn grown in the US is GMO BT corn. What is the best explanation for why so many farmers have decided to grow GMO corn?
Farmers that plant BT corn spray 50% less chemical pesticide per acre compared to farmers that grow traditional corn. Why do these farmers spray less pesticide on BT corn?
Scientist have surveyed biodiversity on farms that grow BT corn compared with farms that grow traditional corn. They have found a greater diversity of insects, spiders and birds in fields of BT corn compared to traditional farming methods. Why is there less biodiversity in field planted with non-BT corn?
What about BT corn might create a new allergen problem?
Why are transgenic crops like BT corn more susceptible to problems associated with monoculture compared with traditional crops. What is the solution to monoculture with transgenic crops?
Explain how use of BT corn might hurt organic farms in this country.
What makes the BT toxin a “good pesticide?”
What societal problem was golden rice designed to solve?
What makes golden rice “golden?”
Give one reason why golden rice is not grown extensively in Asia?
What caused GMO AquAdvantage salmon to grow faster than traditional atlantic salmon?
What as the source of the transgene introduced into AquAdvantage salmon?
What causes traditional salmon to grow slower than AquAdvantage salmon?
The fungal gene for Phytase was used as a transgene to introduce into pigs to generate “Enviropigs.” What trait was improved in these GMO pigs?
In Enviropigs, the phytase gene was linked to a pig promoter that was only active in salivary glands. How does this reduce the risk of an allergen problem with Enviropigs?
The Canadian and US governments approved Enviropigs for farming and human consumption. However, Enviropigs were not popular with farmers. The Canadian government shut down funding of the project and all the transgenic pigs were killed. Why were farmers so quick to use GMO BT corn but not use Enviropigs?
What is Humulin and how is it produced?
How does a Pharm animal differ from a farm animal?
It is much cheaper to produce therapeutic proteins in bacterial than in Pharm animals. Why would a pharmaceutical company ever chose to make a therapeutic protein in a cow.
Why is somatic gene therapy less controversial than germ-line gene therapy?
What transgene was used for gene therapy treatments of SCIDS?
What is SCIDS?
Explain why gene therapy for SCIDS is considered a form of somatic gene therapy and not germ-line gene therapy?
Explain how a transgene would be introduced into humans in germ line gene therapy?
Why were the early efforts at gene therapy to treat SCIDS stopped?
What does the CRISPR enzyme do?
What makes CRISPR highly specific to one region of the chromosome?
Suppose I assigned you to use PCR to amplify the hemoglobin gene. Hemoglobin is expressed in blood cells. Explain why you can use cheek cells as a source of DNA to amplify this gene even though hemoglobin isn’t expressed in cheek cells?
If I gave you the assignment to amplify your own hemoglobin gene by PCR what four items would you need to get.
During PCR, the sample is cycled through 3 temperatures, 94C, 50C and 72. Explain what happens during the PCR reaction at each of those temperatures.
Explain how a PCR experiment can be designed to amplify only the human keratin gene and not the other 20,000 genes found in humans.
Electrophoresis can separate DNA molecules as an electric current carries the DNA in a gel. What causes some of the DNA molecules to migrate faster in the gel than other DNA molecules?
Why do scientist study Short Tandem Repeats for forensic analysis and not a more traditional protein encoding gene?
A paternity test was conducted on three men to determine which might be the father of Betty’s son’s Bruce. The potential fathers who submitted DNA for forensic analysis were Alfred, Antonio and Alex. A single STR was amplified by PCR and the PCR products were analyzed by gel electrophoresis? Based on the gel below, which of the individuals were homozygous and which were heterozygous?
Explain why Alfred can be ruled out as a father of Bruce.
Explain whether Antonio can be ruled out as the father of Bruce?
Do the results prove that Alex is the father?

How does the FBI conduct STR analysis to increase the likelihood of matching a DNA sample to only one individual?
Marvin Anderson was sentence to 210 years in prison after a rape victim positively identified him in a line up. How did the Innocence project prove Marvin Anderson didn’t commit the crime so he could be freed from prison?
How did police collect a sample of Altemio Sanchez’s DNA so that they could prove he was the Bike Path Rapist?
How does embryology support the hypothesis that modern fish and humans once shared a common ancestor?
When biologist say that the flipper of a whale and the wing of a bat are homologous, what do they mean?
How did analysis of fossils of extinct whales suggest whales share a common ancestor with hippopotamuses?
What would you conclude if you found two apparently dissimilar species of cactus whose DNA showed a 99% match?
Biotechnologist believe that the insect pest that feed on corn will develop resistance to the BT toxin found in BT corn. What two things would have to be true about a species of insects before it could evolve resistance?

Exam Questions Fall 2015

Inherited Pedal Polydactylism is the genetic trait associated with having extra toes on the feet. This trait runs in families. A pedigree for a family with this trait is shown below. Darkly shaded individuals have extra toes, lightly shaded individuals have the typical number of toes.

Based on the evidence in this pedigree is Pedal Polydactylism a dominant or recessive trait? Explain your answer.
Two children on the pedigree are identified by name. Indicate the genotypes for those children in the lines below after their names. (Use a capital letter “T” to indicate the dominant allele and lower case “”t to indicate the recessive allele.)

Fred ______Sara ______

Is the mother in the first generation heterozygous? Explain your answer.

In the Labrador retriever breed of dogs, black colored fur is dominant to chocolate colored fur. Suppose you adopted a cute black Labrador retriever, but you knew nothing about the dog’s parents?

Explain how you would conduct a test cross to determine the dog’s genotype for the fur color?
What results would your experiment generate if the dog you adopted were homozygous?

Explain how it is possible for a woman with blood type A and a man with blood type B to have a child with bloodtype B?
What enzyme is primarily responsible for replicating chromosomes during S phase of the cell cycle?
What part of the gene causes transcriptional termination?
Avery boiled virulent (smooth) bacteria and then treated this dead bacterial sample with the enzyme RNAse. He tested this RNAse treated sample and showed that it could still transform avirulent rough bacteria into virulent smooth bacteria. What did this part of his experiment show?
During translation, immediately after forming the peptide bond, the ribosome will “translocate” or move one codon down the messenger RNA. Describe the molecules you would expect to find in the ribosome’s A site and P site immediately after translocation.
Consider polypeptide encoded by the mRNA sequence below?

ACCUCGAUCGACAUAUGUCACGCGUCAAUUAUUCCUAACAUGCUACGAAGAGAGCU

What would be the last amino acid added to the polypeptide chain encoded by this mRNA

Consider the C nucleotide that is circled on the mRNA. Suppose the gene encoding this mRNA suffered a mutation that caused this C to become a G. Explain whether this mutation would be considered a missense mutation or not.