Qiu Et Al ADAR1 and Intestine Supplemental

Qiu et al ADAR1 and intestine supplemental

Last updated on 03/08/2013

Supplemental Methods

Histological Analysis, TUNEL and BrdU Staining

Tissue was fixed in 10% formalin for 24 hr prior to processing. Sections (5µm) from paraffin-embedded tissue were subjected to hematoxylin and eosin (H&E) staining for histological analysis and various staining.

TUNEL staining was performed using an ApopTag Kit (S7101,Chemicon international, Temecula, CA) according to the manufacturer’s instructions. The apoptotic index was scored in 100 crypts and reported as mean SD 1. Three mice were used in each group. For BrdU staining, sections were deparaffinized and treated with proteinase K (20 µg/ml) for 20 min at 37. The staining was carried out following a standard protocol with an anti-BrdU antibody (1:100 in 10% goat serum, cat# A21301MP,Invitrogen, Carlsbad, CA), secondary antibody (goat-anti-mouse-HRP, 1:100; cat#31802, Pierce, Rockford, IL) and developed by DAB (Vector Laboratories, Burlingame, CA) 2. BrdU-positive cells were counted in high-power (400) fields and the percentage of the BrdU-positive cells was determined by counting 100 crypts or villa and reported as mean SD 1. Three or more mice were used in each group.

Immunohistochemical (IHC) and Immunofluorescent (IF) staining

Slides were deparaffinized, rehydrated and treated with 3% hydrogen peroxide. Antigen retrieval was performed by boiling the sections for 10 min in 0.1 M Citrate Buffer Antigen Retrieval Solution (pH 6.0). Non-specific antibody binding was blocked using 20% goat serum for 30 min. For chromogranin A (ChA), lysozyme, Dolichos Biflorus Agglutinin (DBA), and active caspase 3 IHC, the slides were then incubated with rabbit polyclonal anti-ChA (cat# ab15160,Abcam, Cambridge, MA)at 1:50 dilution, goat polyclonal anti-lysozyme (sc-27958, Santa Cruz, Santa Cruz, CA) at 1:50 dilution, Biotinylated-DBA (B1035, Vector Laboratories, Burlingame, CA) at 1:200 dilution, and rabbit polyclonal anti-caspase 3 antibody (cat 9661, Cell signaling, Danvers, MA) at 1:25 dilution, respectively, at 4 overnight. The signals were detected with the ABC kit and DAB kit (Vector Laboratories, Burlingame, CA). The sections were counter-stained with hematoxylin.

For MMP7, Muc2, CHOP, GFP,and immune cell marker IF, the slides were incubated with goat polyclonal anti-MMP7 antibody (cat#AF2967, R&D,Minneapolis, MN) at 1:100 dilution, rabbit polyclonal anti-Muc2 antibody (cat#sc15334,Santa Cruz, Santa Cruz, CA) at 1:100 dilution, rabbit polyclonal anti-CHOP antibody (cat#sc575, Santa Cruz, Santa Cruz, CA) at 1:25 dilution, rat monoclonal anti-Neutrophil antibody (#MCA771GT, AbD serotec, Raleigh, NC) at 1:100 dilution, rabbit anti-Cd45R (B220) (clone AR3-6B2, #25-0452, eBioscience, San Diego, CA) at 1:50 dilution, rabbit anti-CD3epsilon (T cell marker) (#RB-360-A0, Thermo Fisher Scientific, Fremont, CA) at 1:50 dilution, and rabbit anti-Gr-1 (myeloid marker) (clone RB6-8C5) (#550291, BD Biosciences, San Jose, CA ) at 1:50 dilution,respectively. Antibody-antigen complexes were visualized by incubation with Alexa Fluor 594 (Invitrogen, Carlsbad, CA), and counterstained with DAPI (Vector Laboratories, Burlingame, CA). Cells with positive staining were scored in at least 100 crypts or villa and reported as mean ± SD. Three or more mice were used in each group.

RNA in situ hybridization

Probe template containing a 705 bp region of Olfm4 was excised from plasmid DNA, obtained from Hans Clevers. Digoxigenin (DIG)-labeled RNA probes were transcribed using the DIG RNA Labeling kit (SP6/T7) (Roche). Paraffin-embedded tissue was sectioned (5m), rehydrated, denatured with 0.2N HCl, treated with Proteinase K, post-fixedin 4% paraformaldehyde, and acetylated. After a 1 h prehybridizationat 60°C, denatured DIG-labeled probes were hybridized tosections at 60°C for 16–24 h. Hybridization buffercontained 65% formamide, 5x SSC, 2% Roche blocking powder, 1µg/ml yeast tRNA, 50µg/ml heparin, 5 mM EDTA, and 0.05% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate. After a number of washes to decrease salt concentration, slideswere incubated with -DIG–horse radish peroxidase (Abcam), biotinyl tyramide (DAKO), -biotin-horse radish peroxidase (Abcam), and then additional biotinyl tyramide (DAKO) to amplify the signal. Following incubation with -biotin-alkaline phosphatase (Abcam), signal was visualized using nitroblue-tetrazolium-chloride/5-bromo-4-chlor-indolyl-phosphate(Roche) solution. When staining was complete, slides were washedin water and mounted in Clear Mount (EMS). Alternatively, for fluorescent detection, the second biotinyl tyramide amplification step was followed by incubation with streptavidin-Alexa Fluor 488 (Molecular Probes).TUNEL staining immediately followed, as above.

Total RNA Extraction and Real-Time Reverse Transcriptase Polymerase Chain Reaction

Approximately 100 mg of minced fresh tissues or cultured crypts pulled from 3 wells from 24-well plates, were put into 600 µl lysis buffer (cat# Z5111, Promega, Madison, WI). Total RNA was isolated, and cDNA was then generated for real-time PCR analysis 2. Real-time PCR was performed on CFX96 (Bio-Rad, Hercules, CA) with SYBR Green (Invitrogen, Carlsbad, CA). Primers for RT-PCR are listed in Supplemental Table 1, and those for PUMA and inflammatory cytokines have been previously described 3-4. Melting curve and agarose gel electrophoresis of the PCR products were used to verify the specificity of PCR amplification.

Intestinal crypt culture and isolation of Lgr5+ cells

The crypt was isolated and cultured in Matrigel with supplementation of growth factors in 24-well plates, as previously described 5, with minor modifications. Briefly, crypts were released from murine jejunal tissue (~10 cm) by incubation for 30 min at 4 °C in PBS containing 30 mM EDTA with shaking. A total of 500 crypts were mixed with 50 ul Matrigel (Cat# 356231, BD Bioscience, Bedford, MA) and plated in 24-well plates. After polymerization of Matrigel, 500 ul of Advanced DMEM/F12 (Cat# 12634-010, Invitrogen, Grand Island, NY) containing 50 ng/ml EGF (Cat# 315-09, Peprotech, Rocky Hill, NJ), 500 ng/ml R-spondin 1(Cat# 4645-RS, R&D Systems, Minneapolis, MN), (Cat# 250-38, Peprotech, Rocky Hill, NJ), 500 mM N-Acetylcysteine (Cat# A9165, Sigma-Aldrich, St. Louis, MO), 1% N2 supplement (Cat# 17502-048, Invitrogen, Grand Island, NY) and B27 supplement (Cat# 12587-010, Invitrogen, Grand Island, NY) were added. Growth factors were added every other day and the entire medium was changed every 4 days to allow formation of enteroids devoid of non-epithelial cellular niche components 7.

One day after plating, crypts were treated with DMSO or tamoxifen (1-5 nM) for 1 or 2 days. The growth of cultured crypt was followed and photographed under an inverted Microscope (Olympus IX70). On day 2 (48 hours) following tamoxifen treatment, the culture crypts were harvested, fixed with 10% formalin, and processed. Sections (5µm) from paraffin-embedded crypt enteroids were subjected to immunostaining. RNA was isolated from cultured crypts following digestion of the matrix with Dispase (Cat# 354235, BD Biosciences).

Isolation of Lgr5+ cells from mouse intestine

The intestinal cells isolated from 7-8 week old Lgr5-EGFP-IRES-creERT2 mice as previously described5-6, with minor modifications. Briefly, the proximal intestine segment (jejunum, ~10-cm) were collected,flushed gently with cold phosphate-buffered saline (PBS), and cut longitudinally open in a tissue culture dish. Following one PBS rinsed, tissues were incubated in PBS containing 30 mM ethylenediaminetertaacetic acid (EDTA) and 1.5 mM DL-Dithiothreitol (Sigma-Aldrich, St. Louis, MO) on ice for 20 min. Intestinal tissueswere transferred to a 15 ml conical tube containing 5 ml of 30 mM EDTA in PBS, incubated at 37 oC for 8 min, then shaken by hand for 30 seconds at 3 shake cycles per second. After shaking, the remnant muscle layer was discarded, and the dissociated cells were pelleted at 800 g, resuspended in PBS+10% fetal bovine serum (FBS) and repelleted at 400g. The cells were then incubated in 10 ml of modified Hank’s buffered salt solution (mHBSS) containing 0.3 U/ml of dispase (BD Biosciences, Bedford MA) at 37 oC for 10 min with intermittent shaking every 2 mins for 30 sec to dissociate epithelial sheets to single cells. 1 ml FBS and 1000 U DNase (AppliChem, St. Louis, MA) was added to cell suspension and then was sequentially passed through 70 µM and 40 µM filters (BD Biosciences, Bedford, MA). Cells were pelleted and resuspended in 10 ml HBSS and then repelleted and resuspended at a concentration of 2 × 107 cells/ml in intestinal epithelial stem cell (IESC) media (Advanced DMEM/F12 supplemented with 1× N2, 1× B27, 10 mM HEPES, 10 µM Y27632, 100 ug/ml Penicillin/Streptomycin). Approximately 1×107 cells were incubated in 1 ml IESC media with antibodies [α-CD31-PE/Cy7 (Biolegend), α-CD45-PE/Cy7 (Biolegend), and PI,on ice for 30 min with mixing every 10 min. The CD31 /CD45/PI tripled negative population were sorted as total intestinal epithelial cells, and Lgr5 high and low fractions, 10,000 cells each. Pooled samples of two mice were used for RNA preparation.

ADAR1 deletion in cultured MEFs and hepatocytes

Primary MEFsand hepatocytes were isolated from CreER; ADAR1f/fmice and cultured using standard protocols as described 8-9. For ADAR1 deletion in culture, MEF cells were treated with 10 nM TM for 48 hwhile hepatocytes were treated with 200nM for 72 h, or with DMSO (Un). RNA and cDNA were prepared from these cells. The expression ADAR1 deletion and Wnt targets following was determined by RT-PCR.

ADAR1 expression constructs

RNA editing function of ADAR1 depends on the deamination activity and two key residues in its catalytic domain 10-11. We therefore generated H910K/A912E double mutants to ensure the complete inactivation of ADAR1 editing function. The full length ADAR1 cDNA was PCR amplified from mouse spleen cDNA and inserted into pENT-CMV (Invitrogen) vector. The two point mutations were introduced into the WT ADAR1 plasmid by quickchange kit (Qiagen, Valencia, CA, USA). The inserts were fully sequenced and the expression or murine ADAR1 was verified by RT-PCR. More details are available upon request.

Transfection and reporter assays

The human colorectal cancer cell line HCT116 was obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA) and cultured in McCoy’s 5A modified medium (Invitrogen) supplemented with 10% defined fetal bovine serum (Hyclone, Logan, UT, USA), 100 units/mL penicillin, and 100 g/mL streptomycin (Invitrogen). Cells were maintained in a 37°C incubator at 5% CO2. Transfection of HCT116 cells with lipofectamine 2000 (Invitrogen) were performed in 12-well plates using 0.2 µg TCF4 luciferase reporter plasmids, modified Topflash (OT) and Fopflash (OF) 12 , which containing 3 WT or mutant-TCF binding sites, 0.1 µg pCMVβ (Promega), and 0.4 µg WT ADAR1, editing defective mutant (H910K/A912E), or empty vector. The β-galactosidase reporter pCMVβ (Promega) was included to control for transfection efficiency 13. Luciferase and β-galactosidase activities were assessed 48 h after transfection. All reporter experiments were performed in triplicate and repeated on at least three independent occasions.

Supplemental Table 1. Primers used for RT-PCR analysis and genotyping
Gene / Primer / Sequence / reference
ADAR1 / Forward / 5’-GGTGGAAGACTACGCGTTGGGAC-3 / this study
Reverse / 5'-ACGACTGTGTCTGGTGAGGGAACAC-3’
ADAR1 / Forward / 5-CCGTACCATGTCCTGTAGTGACA-3 / 14
Reverse / 5-CGGGAACCGACTTTTCCATTG-3
Lgr5 / Forward / 5'-GACAATGCTCTCACAGAC -3' / 15
Reverse / 5'-GGAGTGGATTCTATTATTATGG-3'
Bmi1 / Forward / 5'-TATAACTGATGATGAGATAATAAGC-3' / 15
Reverse / 5'-CTGGAAAGTATTGGGTATGTC-3'
IRF7 / Forward / 5’-TTGATTCTCCCAGACTGCCTGTGTAGAC-3’ / 16
Reverse / 5’-CTCGTACTGGCCGCTGCTGAC-3’
IRF9 / Forward / 5’-GCCACCATTAGAGAGGACCCAGTG-3’ / 16
Reverse / 5’-TAGATGAAGGTGAGCAGCAGCGAG-3’
STAT1 / Forward / 5’-TGGGAACGGAAGCATTTGGAATCTC-3’ / 16
Reverse / 5’-GAAACTGTCATCGTACAGCTGGTGGAC-3’
FI35 / Forward / 5’-TGAGAGCCATGTCTGTGACCCTGC-3’ / 16
Reverse / 5’-CTGGCTTGCTCCTCCTGAAGACTG-3’
PKR / Forward / 5’-AATTATGAACAGTGTGAGCCCAACTCTG-3’ / 16
Reverse / 5’-ACACCTGAACCAGTACCATACATTGTCTG-3’
GAPDH / Forward / 5’-CTCTGGAAAGCTGTGGCGTGATG-3’ / 17
Reverse / 5’-ATGCCAGTGAGCTTCCCGTTCAG-3’
cyclin D1 / Forward / 5’-AGTCAGGGCACCTGGATTGTTC-3' / 18
Reverse / 5’-AACAGATTAAATGATGCACCGGAGA-3’
c-Myc / Forward / 5′-TCTCCACTCACCAGCACAACTACG-3' / 19
Reverse / 5′-ATCTGCTTCAGGACCCT-3'
EphB2 / Forward / 5′ AAGATGGGCCAGTACAAGGA 3′ / 20
Reverse / 5′ CCAGCTAGAGTGACCCCAAC 3′
EphB3 / Forward / 5' AAGAGACTCTCATGGACACGAAATG 3' / 15
Reverse / 5'ACTTCCCGCCGCCAGATG 3'
Lef1 / Forward / 5′ AGACACCCTCCAGCTCCTGA 3′ / 20
Reverse / 5′ CCTGAATCCACCCGTGATG 3′
Cdx1 / Forward / 5' CTAGGACAAGTAGCTTGCCCTCTT 3' / 21
Reverse / 5' TCCAACAGGCTCACCACACA 3'
Sox9 / Forward / 5' ATTCCTCCTCCGGCATGAGT 3' / 22
Reverse / 5' GCTGCTCAGTTCACCGATGT 3'
Wnt 3A / Forward / 5' CACCACCGTCAGCAACAGCC 3' / 23
Reverse / 5' AGGAGCGTGTCACTGCGAAAG 3'
ADAR1/Cre genotyping primers sets:
Gene / Primer / Sequence / reference
ADAR1 / PR-1: / 5′-CGGGATCCCCAAGGTGGAGAATGGTGAGTGGTA-3′ / 8
ADAR2 / PR-2: / 5′-GCTCTAGAAGAGGGCACAGCCACAGCAGGAC-3′
ADAR3 / PR-4: / 5′-GCTCTAGAGAATCAAACCCACAAGAGGCCAGTG
Cre / PRCre-1 / 5′-GGCCAGCTAAACATGCTTCATCGTC-3′
Cre / PRCre-2 / 5′-ACGTAACAGGGTGTTATAAGCAATCCC-3′

Supplemental References

1.Qiu W, Carson-Walter EB, Kuan SF, Zhang L, Yu J. PUMA suppresses intestinal tumorigenesis in mice. Cancer Res 2009; 69(12): 4999-5006.

2.Qiu W, Carson-Walter EB, Liu H, Epperly M, Greenberger JS, Zambetti GP et al. PUMA regulates intestinal progenitor cell radiosensitivity and gastrointestinal syndrome. Cell Stem Cell 2008; 2(6): 576-83.

3.Qiu W, Leibowitz B, Zhang L, Yu J. Growth factors protect intestinal stem cells from radiation-induced apoptosis by suppressing PUMA through the PI3K/AKT/p53 axis. Oncogene 2010; 29(11): 1622-32.

4.Qiu W, Wu B, Wang X, Buchanan ME, Regueiro MD, Hartman DJ et al. PUMA-mediated intestinal epithelial apoptosis contributes to ulcerative colitis in humans and mice. J Clin Invest 2011; 121(5): 1722-32.

5.Sato T, Vries RG, Snippert HJ, van de Wetering M, Barker N, Stange DE et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature 2009; 459(7244): 262-5.

6.Barker N, van Es JH, Kuipers J, Kujala P, van den Born M, Cozijnsen M et al. Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature 2007; 449(7165): 1003-7.

7.Stelzner M, Helmrath M, Dunn JC, Henning SJ, Houchen CW, Kuo C et al. A nomenclature for intestinal in vitro cultures. Am J Physiol Gastrointest Liver Physiol 2012; 302(12): G1359-63.

8.Wang Q, Miyakoda M, Yang W, Khillan J, Stachura DL, Weiss MJ et al. Stress-induced apoptosis associated with null mutation of ADAR1 RNA editing deaminase gene. J Biol Chem 2004; 279(6): 4952-61.

9.Oh HY, Namkoong S, Lee SJ, Por E, Kim CK, Billiar TR et al. Dexamethasone protects primary cultured hepatocytes from death receptor-mediated apoptosis by upregulation of cFLIP. Cell Death Differ 2006; 13(3): 512-23.

10.Lai F, Drakas R, Nishikura K. Mutagenic analysis of double-stranded RNA adenosine deaminase, a candidate enzyme for RNA editing of glutamate-gated ion channel transcripts. J Biol Chem 1995; 270(29): 17098-105.

11.Liu Y, Samuel CE. Mechanism of interferon action: functionally distinct RNA-binding and catalytic domains in the interferon-inducible, double-stranded RNA-specific adenosine deaminase. J Virol 1996; 70(3): 1961-8.

12.da Costa LT, He TC, Yu J, Sparks AB, Morin PJ, Polyak K et al. CDX2 is mutated in a colorectal cancer with normal APC/beta-catenin signaling. Oncogene 1999; 18(35): 5010-4.

13.Yu J, Zhang L, Hwang PM, Kinzler KW, Vogelstein B. PUMA induces the rapid apoptosis of colorectal cancer cells. Mol Cell 2001; 7(3): 673-82.

14.Wang Q, Khillan J, Gadue P, Nishikura K. Requirement of the RNA editing deaminase ADAR1 gene for embryonic erythropoiesis. Science 2000; 290(5497): 1765-8.

15.Snippert HJ, van Es JH, van den Born M, Begthel H, Stange DE, Barker N et al. Prominin-1/CD133 marks stem cells and early progenitors in mouse small intestine. Gastroenterology 2009; 136(7): 2187-2194 e1.

16.Hartner JC, Walkley CR, Lu J, Orkin SH. ADAR1 is essential for the maintenance of hematopoiesis and suppression of interferon signaling. Nat Immunol 2009; 10(1): 109-15.

17.Qiu W, Wang X, Leibowitz B, Yang W, Zhang L, Yu J. PUMA-mediated apoptosis drives chemical hepatocarcinogenesis in mice. Hepatology 2011; 54(4): 1249-58.

18.Gu Y, Zhang S, Wu Q, Xu S, Cui Y, Yang Z et al. Differential expression of decorin, EGFR and cyclin D1 during mammary gland carcinogenesis in TA2 mice with spontaneous breast cancer. J Exp Clin Cancer Res 2010; 29: 6.

19.Meyer-Bahlburg A, Bandaranayake AD, Andrews SF, Rawlings DJ. Reduced c-myc expression levels limit follicular mature B cell cycling in response to TLR signals. J Immunol 2009; 182(7): 4065-75.

20.Bhanja P, Saha S, Kabarriti R, Liu L, Roy-Chowdhury N, Roy-Chowdhury J et al. Protective role of R-spondin1, an intestinal stem cell growth factor, against radiation-induced gastrointestinal syndrome in mice. PLoS One 2009; 4(11): e8014.

21.Crissey MA, Guo RJ, Fogt F, Li H, Katz JP, Silberg DG et al. The homeodomain transcription factor Cdx1 does not behave as an oncogene in normal mouse intestine. Neoplasia 2008; 10(1): 8-19.

22.Kawaguchi J, Nichols J, Gierl MS, Faial T, Smith A. Isolation and propagation of enteric neural crest progenitor cells from mouse embryonic stem cells and embryos. Development 2010; 137(5): 693-704.

23.Kemp C, Willems E, Abdo S, Lambiv L, Leyns L. Expression of all Wnt genes and their secreted antagonists during mouse blastocyst and postimplantation development. Dev Dyn 2005; 233(3): 1064-75.

Supplemental Figure Legends

Figure S1. ADAR1 loss induces apoptosis in the small intestinal crypts.

(A)Dosing and schedule of tamoxifen treatment. ADAR f/f (control, or ER -) or CreER; ADARf/f (ER+) mice were subjected to 120 mg/kg tamoxifen (TM) administration(s). Intestinal tissues were harvested, and analyzed on day 0 (Un), 1 (1x TM), 2 (2x TM), 3 (2x TM), or 5 (3x TM), black arrows indicate tissue harvest before the injection of that day. (B)Deletion of ADAR1 in intestinal mucosa assessed by genomic PCR. The upper and lower bands indicated the deletion of (∆) or the floxed allele (ADAR1f/f). (C) Apoptosis was assessed by TUNEL, magnification ×400. Arrow heads indicate examples of TUNEL+ cells. (D) Apoptosis was assessed by active caspase 3 staining (brown) on day 0, 3, and 5, magnification ×400. Arrow heads indicate examples of active capspase 3+ cells. (E) Apoptosis was assessed by TUNEL staining (brown) at day 1 and 2, magnification ×200. (F) Same as (E) with magnification ×400. Arrow heads indicate examples of TUNEL+ cells.

Figure S2. ADAR1 loss induces cell death and injury in mouse colon.

ADAR f/f or CreER; ADARf/f mice were subjected to tamoxifen (TM) administration(s) as in Fig. S1A. Colon tissues were harvested at the indicated days (D). (A) H&E staining of colon tissues, magnification ×200. (B) TUNEL staining of colon tissues, magnification ×200. (C) Higher magnification TUNEL staining on day 5 from (B), magnification ×400. Arrow heads indicate examples of TUNEL+ cells.

Figure S3. ADAR1 loss induces cell death in several tissues.

ADAR f/f or CreER; ADARf/f mice were subjected to tamoxifen (TM) administration(s) as in Fig. S1A. The indicated tissues were harvested and analyzed on day 5 for H&E (left) and TUNEL (right) staining, magnification ×200.

Figure S4. ADAR1 loss induces death of intestinal stem cell death.

ADAR f/f or CreER; ADARf/f mice were subjected to tamoxifen (TM) injection(s) as in Fig. S1A. (A) IF staining of Olfm4 ISH, TUNEL, and DAPI (nuclei) in the small intestine on day 3, magnification ×400. (B) IF staining of MMP7 (Paneth cell marker), TUNEL, and DAPI (nuclei) in the small intestine on day 3, magnification ×400.

Figure S5. Deletion of ADAR1 impairs differentiation of the intestinal epithelium.

ADAR f/f or CreER; ADARf/f mice were subjected tamoxifen (TM) administration(s) as Fig. S1A. Intestinal tissues were harvested at the indicated days (D). (A) Represntative pictures of enterocytes stained by Alkaline phosphotase, magnification ×200. (B) Representative pictures of enteroendocrine cells stained by chromogranin A (red), magnification ×200. (C) Quantification of ChA staining in the crypts. Values are means ± SD. n = 3 mice in each group.

Figure S6. Deletion of ADAR1 causes expansion and mislocalization of Paneth cells in the small intestine.

ADAR f/f or CreER; ADARf/f mice were subjected to tamoxifen (TM) injection(s) as in Fig. S1A. Intestinal tissues were harvested at the indicated days (D). (A) Representative pictures of Paneth cells stained by MMP7 (red), magnification ×200. (B) Quantification of MMP7 staining in the villi. Values are means ± SD. n = 3 mice in each group. (C)Representative pictures of Paneth cells stained by lysozyme (brown), magnification ×200. Arrow heads indicate examples of lysozyme+ cells located in upper crypts or villi. . (D)Representative pictures ofSox9 staining, magnification ×400. (E) Confirmation of the expression of murine WT ADAR1 or editing mutant 910K/912E by RT-PCR in HCT 116 cells.

Figure S7. ADAR1 deletion rapidly activates interferon signaling in the intestinal mucosa.

ADAR f/f or CreER; ADARf/f mice were subjected to tamoxifen (TM) injection(s) as in Fig. S1A. Expression of the indicated interferon signaling genes in the small intestinal mucosa was analyzed by real-time RT-PCR. *P < 0.05 compared with the control (day 0).

Figure S8.ADAR1 deletion induces infiltration of immune cells in the small intestine.

ADAR f/f or CreER; ADARf/f mice were subjected to tamoxifen (TM) injection(s) as in Fig. S1A. Intestinal tissues were harvested at the indicated days (D). (A) Representative pictures of neutrophil antigen staining, magnification ×200. (B)Representative pictures of B220 staining, magnification ×200. (C)Representative pictures of Cd3e staining, magnification ×200. (D)Representative pictures of Ly6G staining, magnification ×200.

Figure S9. ADAR1 deletion induces intestinal crypt cell death and ER stress in vitro.

Small intestinal crypts were isolated from ADAR f/f or CreER; ADARf/f mice and plated into Matrigel for 24 hours (day 0) as described in methods. Culture crypts were subjected to 0 (DMSO), 1, 2, or 5 nM of tamoxifen (TM), or DMSO (Un), and analyzed on day 0, 1, or 2. (A) Representative pictures of cultured crypts on day 0, 1, or 2, magnification ×100. (B) Quantification of active caspase 3 staining in the cultured crypts on day 2, magnification ×400. (C) Representative pictures ofCHOP staining in the cultured crypts on day 2, magnification ×400.