Name: ______Date: ______Per. _____

Protein Synthesis Simulation

  1. Start at the "nucleus". Pick up a DNA strand and write the number of the DNA strand here: ______

11-DNA TACCGAGGCTCTCCTCCGTCTCCCATC

  1. Staying in the "nucleus", transcribe the DNA above into mRNA. Write the mRNA sequence here:

______

  1. Go to one of the "ribosomes" and write the tRNA sequence that corresponds to your mRNA here:

______

  1. Split the tRNA sequence into anti-codons (groups of 3 letters)
  1. Look below for the mRNA cards that match your anti-codons.(when using a codon chart always look up the mRNA, NOT the tRNA!!!)

Write down the words in order.

______

mRNA card with Words (that go on the back):

AUG = Initiator (Start) CCU = subject CGG = everyAGU = BeatlesUAG- stop

AAA = Your CGA = drink CGU = dayAGC = bestUUG = for

AAC = mother AAG = wears AAU = dressesAUA = rockUUC = code

ACG = funny ACC = have ACU = dogAUC = bandUUA= DNA

ACA = breath AGA = the AGG = areAUU= anUGU = little

CAA = oldCAC = rubber CAG = breaks. CAU = pulledCGC = water

CCA = when CCC = Biology CCG = isCUA = ICUC = love

CUG = roll CUU = musicGAA = all GAC = demented UUU= life

GAG = puppiesGAU = and GCA = so GCC = muchUGG = read

GCG = fun GCU = education GGA = doorGGC = to UGC = you

GGG = future GGU = fatherGUA = a GUC = dress UGA = around

GUG = brotherGUU = nothing UAA = we UAC = in UCU = informed

UAU= this UCA = together UCC = mustUCG = be

Questions:

1. Why did you have to stay in the "nucleus" to write down the mRNA?

2. Which part of this activity represents transcription?

3. Which part of this activity represents translation?

4. What happens in the ribosomes during protein synthesis?

5. What does the final sentence represent in terms of protein synthesis?

6. What does each word represent in terms of protein synthesis?

7. All DNA sequences started with TAC and ended with ATC? Why?

8.How does this activity differ to doing protein synthesis problems using the genetic code?

Using a Codon Chart, Transcribe and Translate the following DNA Strands:

  1. DNA:T A C T C G C A T C G T A G G A T C
  2. mRNA: ______
  3. tRNA: ______
  4. Amino Acid Sequence: ______
  1. DNA:T TT A C G G C T A G T A C T
  2. mRNA: ______
  3. tRNA: ______
  4. Amino Acid Sequence: ______
  1. If something goes wrong and the sequencing of the DNA is changed what do we call that? ______

Compare the following DNA sequencing from the DNA sequencing in #5.

  1. DNA:T TT A C T G C T A G T A C T
  2. mRNA: ______
  3. tRNA: ______
  4. Amino Acid Sequence: ______
  5. What was the difference between the DNA sequence in # 5 and #10?

______

  1. Because of the difference between the 2 DNA strands what happened with the new Amino Acid sequence?

______

  1. What does a chain of Amino Acids make? ______
  2. Would the correct protein be made from the DNA strand in #10? ______, WHY? ______