Plant Materials, Bacterial Pathogens and Growth Conditions

SupplementalData

Materials and Methods

Plant materials, bacterial pathogens and growth conditions

Three-week-old Nicotiana benthamiana seedlings were transplanted to 4-inch pots containing Professional Blend soil (SUNGRO Horticulture Distribution Inc., Bellevue, WA) and grown in the greenhouse under the following conditions: 20 ± 2ºC, 70% humidity and 16 hours daylight supplemented with 50-100 μE sec-1m-2 light intensity.

N. benthamiana cDNA library construction

A cDNA library was made from N. benthamiana leaf tissues treated with biotic and abiotic elicitors, cloned into pTRV2-based gateway vector and transformed into Agrobacterium tumefaciens GV2260 (Anand et al., 2007).

VIGS in N. benthamiana

The cDNA library in 96-well plates was transferred to large plates with solid LB agar medium and grown for two days at 28ºC. Bacterial cells of A. tumefaciens GV2260 containing pTRV1 vector were collected from overnight culture, washed twice, resuspended in MES buffer (10 mM MgCl2, 10 mM MES) with the optical density at OD600 = 1 and infiltrated into the lower leaves of N. benthamiana plants at the four-leaf stage using a needleless syringe. The individual pTRV2 derivative cDNA clones were grown on LB agar medium plates for twodays and directly picked and pricked on the leaf area infiltrated with the pTRV1. Plants were kept in the greenhouse (20 ± 3ºC; 70% humidity; 16-h photoperiod with supplemental lighting 50-100 μE s–1 m–2). Two plants were inoculated with each clone for initial screening. In subsequent secondary and tertiary screenings, four plants were inoculated with each clone.

Silencing of the selected candidate clones was conducted by leaf infiltration as previously described (Ryu et al., 2004; Senthil-Kumar and Mysore, 2011). Briefly,A. tumefaciens strain GV2260 containing pTRV1 or pTRV2 with each cDNA clone was cultured in LB medium overnight at 28ºC. Bacterial cells containing pTRV1- or pTRV2-derivated plasmids were harvested by centrifugation and were resuspended in MES buffer, mixed at a 1:1 ratio and inoculated into the lower leaves of N. benthamiana plants at the four-leaf stage by syringe infiltration.

Cloning of full length NbSQS gene from N. benthamiana

The 6C8 clone in pTRV2 vector was sequenced and the full length gene was cloned using FirstChoice RLM-RACE kit (Ambion, Austin, TX) by following the manufacturer’s instructions. Briefly, to clone the full length gene NbSQS, total RNA was extracted from N. benthamiana leaves using the RNeasy Kit (Qiagen, Valencia, CA) by following the manufacturer’s instructions. To clone the 5’ end of the NbSQS gene, total RNA was first treated with calf intestine alkaline phosphatase (CIP) to remove free 5’-phosphates from fragmented mRNA, ribosomal RNA and tRNA. After phenol extraction, the RNA was then treated with tobacco acid pyrophosphatase (TAP) to remove the cap structure from full length mRNA. A 45 base RNA adapter oligonucleotide was then ligated to the RNA using T4 RNA ligase at 37ºC for 1 hour. The ligated RNA was used for reverse transcription at 42ºC for 1 hour using random decamers provided by the manufacturer. The cDNA was then used to amplify the 5’ end of the NbSQS gene by nested PCR using the following primer sets: outer 5’RACE1 (reverse, 5’ -GGTCTTCGTAAT TATCTTGTCAG- 3’) and 5’ RACE manufacturer-supplied (forward) outer primer; inner 5’RACE2 (reverse, 5’- CATCAAAATCTGCACTAATCACAC) and 5’ RACE inner manufacturer-supplied (forward) primer. The PCR products were purified and cloned into pGEM-T vector (Promega Corporation, Madison, WI). To clone the 3’ end of NbSQS, first strand cDNA was directly synthesized from total RNA using the supplied 3’ RACE adapter. The cDNA was then subjected to nested PCR using the forward primers 3’RACE1 outer (forward, 5’ –GTGTGATTAGTGCAGATTTTGATG- 3’) and 3’RACE2 inner (forward, 5’- CCTGACAAG ATAATTACGAAGAC -3’) in addition to the manufacturer-supplied primers. The cloned ends of NbSQS were sequenced and used for full gene cloning.

Real-time PCR analysis

Total RNA was extracted from plant leaves using the RNeasy Kit (Qiagen, Valencia, CA) by following the manufacturer’s instructions. RNA concentration was measured using the Nanodrop® ND-1000 UV-Vis Spectrophotometer (NanoDrop Technologies, Inc., Wilmington, DE) and adjusted to 1 µg/µl. Reverse transcription was carried out with 2 µg of total RNA and 0.5 μg of poly (dT)16 primer in a final volume of 20 µl for 1 hour at 37ºC using Omniscript RT Kit (Qiagen, Valencia, CA) and RNAase inhibitor (Promega, Madison, WI). Gene-specific primers for PCR were designed using PrimerExpress software (AppliedBiosystems, ABI, Foster City, CA)and synthesized by Integrated DNATechnologies (Coralville, IA) for NbSQS (NbSQSF, 5’- CTTACATGTCTGCTTTGC GTGAT -3’, NbSQSR, 5’- TGCCATGACCTGTGGAATAGC -3’), AtSQS1 (AtSQS1F, 5’- TACGAGGAGAACACAAACAAATCC -3’, AtSQS1R, 5’- GCAAGGAAACCATGTATTTCAGG -3’) and AtCYP710A1 (AtCYP710A1F, 5’- GCACTCGGGAGACGAAGAGA -3’, AtCYP710A1R, 5’- TTGAGCGGCAAAGAGAA AATC -3’). Primer concentrations were optimized, and specific amplification was confirmed with melting curve assay and agarose gel electrophoresis. Real-time quantitative PCR was performed with the ABI 7900HT Fast Real-Time PCR System (Applied Biosystems, Carlsbad, CA) using Power SYBR Green PCR Master Mix (ABI) at the following conditions: 95ºC for 10 min, 40 cycles of 95ºC for 15 s and 60ºC for 1 min. The quality of amplification was determined using the dissociation curve analysis. Three biological replicates and three technical replicates were used for each line or treatment. Threshold cycle (CT) values were used for data analysis. Relative quantification ofPCR products was calculated by the comparative CT method (ΔCT) using N. benthamiana actin (NbactinF, 5’ – TGCCCTGAGGTCCTTTTCC -3’, NbactinR, 5’- CTCGTGGATTCCAGCTGCTT -3’) or Arabidopsis elongation factor 1 (EF1-) (AtEF-1F, 5’ – ACCTTTGCTCCCACAGGATTG -3’, AtEF-1R, 5’ – CAAGAAGAGACTCGTGGTG CAT -3’) as endogenous controls (Pfaffl, 2001).

Electrolyte leakage assay

Electrolyte leakage was measured using the method described earlier (del Pozo et al., 2004) with modifications. Two leaf discs (0.5 cm2 each, avoiding major leaf veins) from fully expanded young leaves of N. benthamiana plants were placed in a 10 ml glass tube containing 5 ml miliQ water and gently shaken for 4 hours at room temperature. The conductivity of the solution was measured (initial reading) using a conductivity meter (pHuture MMSTM 555A, ThermoOrion, Beverly, MA, U.S.A.). The tubes with the leaf discs were then autoclaved. After cooling to room temperature, total conductivity of the solutions was measured again (final reading). Electrolyte leakage was calculated as a percentage of the conductivity before autoclaving to the conductivity after autoclaving. Formula used is given below:

Leakage (%) = / conductivity of solution after 4 hrs shaking / X 100
total conductivity of solution after autoclaving

AtSQS1 RNAi vector construction and plant transformation of Arabidopsis

Total RNA was extracted from Arabidopsis Col-0 plant leaves using the RNeasy Kit (Qiagen, Valencia, CA) by following the manufacturer’s instructions. Reverse transcription was carried out with 2 µg of total RNA and 0.5 μg of poly (dT)16 primer in a final volume of 20 µl for 1 hour at 37ºC using Omniscript RT Kit (Qiagen) and RNAase inhibitor (Promega, Madison, WI). Since arms of 400 to 800 nt in intron-containing hairpin RNA constructs showed stable and effective silencing efficiency with an average of about 90% (Wesley et al., 2001), a 798-bp DNA fragment was amplified from AtSQS1 cDNA (RNAiAtSQS1F, 5’ – ggggacaagtttgtacaaaaaagcag gctGATTGAGAAAGCGGAGAAGCAGA -3’, RNAiAtSQS1R, 5’ – ggggaccactttgtacaagaaa gctgggtGCACAGAACCGAAATATGGAAGGA -3’). The PCR product was gel-purified and cloned into a Gateway donor vector pDNOR207 by BP reaction based on the manufacturer’s instructions (Invitrogen Corporation, Carlsbad, CA). The DNA fragment was then cloned into the gateway-ready binary vector pK7GWIWG2(I) (Karimi et al., 2002) under the control of the CaMV 35S promoter, resulting in a vector pK7-AtSSi which was transformed into Agrobacterium tumefaciens GV 2260 and used for AtSQS1 gene silencing. Arabidopsis transformation was conducted by the flower dipping method (Clough and Bent, 1998).

Phytosterol extraction and analysis

Homogenized dry tissue (20 mg) was used to extract the total sterols in 5 mL chloroform/methanol (1:2, v/v) with gentle shaking at room temperature. The sterols were recovered in the organic phase by adding 2 ml of 1% (w/v) KCl and 1 ml of chloroform. After centrifugation for 30 min at 2,900 g, the crude extracts were transferred to a fresh tube and washed by adding 2 ml of methanol/water (10:9, v/v). The organic phase was separated by centrifugation, transferred to a fresh tube and dried under a nitrogen stream. The sterols were then saponificated in 2.5 ml of 1M KOH in methanol for 1 hour at 20ºC, and the organic phase was recovered by adding 2 ml chloroform and 2.5 ml of water. The organic phase was washed once by adding 1.25 ml of 0.5 M KOH and 6 ml of water, centrifuged, transferred to a fresh tube and dried under a nitrogen stream. The total phytosterols were resuspended in 0.8 ml of chloroform and hydrolyzed by adding 0.5 ml of 1.25M HCl in methanol and incubated at 50ºC for 4 hours. Following hydrolysis, the solvents and HCl were evaporated under nitrogen. The sample was then resuspended in 70 ul pyridine and incubated at 50ºC until residue was resuspended and derivatized through the addition of 30 ul of MSTFA with 1% TMCS and incubated for 1 hour at 50ºC. One microliter of the sample was injected at 1:1 split ratio for GC-MS analysis.

Silencing of the CYP710A1 gene by VIGS in N. benthamiana and tomato

VIGS for N. benthamiana was performed as described above. A fragment of AtCYP710A1 gene was cloned in TRV2-VIGS vector using primers (5’-3’) NtCYP710A1F-ggggacaagtttgtacaaaaaagcaggctAGAGGCAAGAGGAACGGGTTTACA andNtCYP710A1R-ggggaccactttgtacaagaaagctgggTCCCATTCTTGCAATTGCTCCTC.

VIGS for tomato was performed as described (Senthil-Kumar and Mysore, 2011). A fragment of the AtCYP710A1 gene was cloned in TRV2-VIGS vector using primers (5’-3’) SlCYP710A1F -ggggacaagtttgtacaaaaaagcaggctACACCCTTTCGGTTTGTGTGGAAC and SlCYP710A1R- ggggaccactttgtacaagaaagctgggTTTCATTTCCGTGAGCATTTCCGCC.

Literature cited

Anand A, Vaghchhipawala Z, Ryu C-M, Kang L, Wang K, del-Pozo O, Martin GB, Mysore KS (2007) Identification and characterization of plant genes involved in Agrobacterium-mediated plant transformation by virus-induced gene silencing. Mol Plant Microbe In 20: 41-52

Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735-743

del Pozo O, Pedley KF, Martin GB (2004) MAPKKK alpha is a positive regulator of cell death associated with both plant immunity and disease. EMBO J 23: 3072-3082

Karimi M, Inze D, Depicker A (2002) GATEWAY vectors for Agrobacterium-mediated plant transformation. Trends Plant Sci 7: 193-195

Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29: 2002-2007

Ryu CM, Anand A, Kang L, Mysore KS (2004) Agrodrench: a novel and effective agroinoculation method for virus-induced gene silencing in roots and diverse Solanaceous species. Plant J 40: 322-331

Senthil-Kumar M, Mysore KS (2011) Virus-induced gene silencing can persist for more than 2 years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato. Plant Biotechnol J: 9: 797-806

Wesley SV, Helliwell CA, Smith NA, Wang MB, Rouse DT, Liu Q, Gooding PS, Singh SP, Abbott D, Stoutjesdijk PA, Robinson SP, Gleave AP, Green AG, Waterhouse PM (2001) Construct design for efficient, effective and high-throughput gene silencing in plants. Plant J 27: 581-590

Table S1. Increased compounds in apoplast extracted from the SQS-silenced N. benthamiana compared to the control

Compounds / Amount Ratio
NbSQS/Control apoplast
Raffinose / 49.77176
D-(+)-Melibiose / 22.78444
Trehalose / 21.26795
Isomaltose / 9.884592
D-(-)-Ribose / 8.195267
Pipecolic Acid / 8.081129
D-(+)-Glucose / 8.050032
Glycerol / 8.028161
Maltose Monohydrate / 7.395307
Gluconic Acid / 7.274499
D-(+)-Galactose o-methyloxime 2 / 6.898384
Sorbitol / 6.717685
Succinic Acid / 6.512995
L-Leucine / 6.397192
Ononitol / 6.189772
D-(-)-Fructose / 6.106408
Melezitose / 5.961419
n-Octyl-beta-D-glucoside / 5.78862
Rhamnose Meox / 4.973101
Galactaric Acid / 4.882486
D-(+)-Mannose / 4.846378
Xylitol / 4.755642
Cytosine / 4.072298
Citric Acid / 3.922113
Disiloxane, Hexamethyl / 3.750977
Tartaric Acid / 3.660392
L-Serine / 3.605821
Galactosyl glycerol / 3.384596
Erythritol / 3.346712
Xylose / 3.116408
Citramalic Acid / 2.527943
Phosphoric Acid / 2.451068
Pinitol / 2.42027
Malic Acid / 2.150153
Fumaric Acid / 2.100288

Table S2. Metabolite profiling of apoplasts showing relative amounts of compounds upon pathogen inoculation. The wild-type N. benthamiana plant leaves were inoculated with P. syringae pv.glycinea and P. syringae pv. tabaci at aconcentration of ~5×104 cfu/ml by vacuum infiltration. Apoplastic fluid was extracted from leaves every 24 hrs after inoculation by vacuum-centrifuge method and filtered to remove bacterial contamination. The polar components in apoplastic fluid were determined by GC-MS and compared with those at day 0. The relative amount (the ratio between each dpi and 0 dpi) of each component was the average of three biological replicates.

Mock / Psg / Pta
Retention time, Compound / Day 1 / Day 2 / Day 3 / Day 4 / Day 1 / Day 2 / Day 3 / Day 4 / Day 1 / Day 2 / Day 3 / Day 4
12.0592,Unknown / 0.74 / 0.85 / 0.90 / 1.04 / 1.13 / 0.68 / 0.77 / 0.97 / 1.14 / 8.68 / 9.20 / 7.78
12.066,Unknown / 0.52 / 0.91 / 0.92 / 1.34 / 1.35 / 0.95 / 0.69 / 1.03 / 1.13 / 11.92 / 12.63 / 10.38
12.5157,Disiloxane, Hexamethyl / 0.94 / 1.11 / 1.02 / 0.71 / 0.76 / 0.82 / 0.56 / 0.88 / 0.52 / 0.39 / 0.28 / 0.27
12.692,Unknown / 0.92 / 1.08 / 0.83 / 0.90 / 0.90 / 1.42 / 1.16 / 1.36 / 0.93 / 0.71 / 0.49 / 0.75
13.0406,Unknown / 0.33 / 0.35 / 0.29 / 0.17 / 0.64 / 0.47 / 0.98 / 0.66 / 0.32 / 5.85 / 9.18 / 10.76
13.2719,Unknown / 0.97 / 1.15 / 1.00 / 0.84 / 0.87 / 1.08 / 0.81 / 1.11 / 0.78 / 0.59 / 0.44 / 0.53
13.3628,Silanamine, / 0.97 / 0.98 / 0.95 / 0.93 / 0.98 / 1.08 / 0.83 / 1.32 / 1.25 / 1.11 / 0.68 / 0.72
13.5438,Unknown / 0.99 / 1.20 / 0.93 / 1.02 / 0.98 / 1.36 / 0.94 / 1.38 / 1.42 / 1.22 / 0.80 / 1.04
13.6273,Oxalic Acid / 0.77 / 0.81 / 0.97 / 0.69 / 0.56 / 0.77 / 0.89 / 0.49 / 0.44 / 1.30 / 2.47 / 2.54
14.1441,Pentasiloxane Dodoecamethyl / 0.83 / 0.87 / 0.78 / 0.88 / 0.72 / 0.94 / 0.89 / 0.97 / 0.81 / 0.75 / 0.75 / 0.75
14.1481,Unknown / 0.89 / 0.90 / 0.83 / 0.90 / 0.77 / 0.96 / 0.89 / 0.96 / 0.81 / 0.75 / 0.79 / 0.76
14.1637,L-Leucine / 1.78 / 1.59 / 1.06 / 0.75 / 1.17 / 1.71 / 1.70 / 2.05 / 0.49 / 3.44 / 85.10 / 53.54
14.5218,Unknown / 0.92 / 0.88 / 0.99 / 1.01 / 1.02 / 1.10 / 0.92 / 1.41 / 1.26 / 1.14 / 0.75 / 0.80
14.591,Unknown / 1.67 / 1.05 / 3.85 / 1.85 / 1.19 / 1.12 / 1.79 / 1.54 / 0.56 / 16.89 / 33.45 / 36.37
14.7931,L-Isoleucine / 0.68 / 1.48 / 3.40 / 1.99 / 0.74 / 0.39 / 1.09 / 0.37 / 0.99 / 1.27 / 13.35 / 11.56
15.0848,Lactic Acid / 1.41 / 1.56 / 3.45 / 2.36 / 1.86 / 1.32 / 2.83 / 2.89 / 1.28 / 2.71 / 8.03 / 10.30
15.1485,Unknown / 0.62 / 0.44 / 0.14 / 0.62 / 0.71 / 0.81 / 0.77 / 0.21 / 0.20 / 0.86 / 2.03 / 1.58
15.1519,Unknown / 0.49 / 0.98 / 1.33 / 0.87 / 0.85 / 0.74 / 1.15 / 1.38 / 0.84 / 2.64 / 6.16 / 7.29
15.5514,Unknown / 2.99 / 0.81 / 1.14 / 3.66 / 1.08 / 3.03 / 0.58 / 3.60 / 0.82 / 17.10 / 36.95 / 34.12
15.7223,N-Butylamine / 0.95 / 0.92 / 0.99 / 0.93 / 0.93 / 1.04 / 0.83 / 1.28 / 1.29 / 1.12 / 0.74 / 0.77
16.0207,Unknown / 0.89 / 0.98 / 0.89 / 0.98 / 1.18 / 1.61 / 1.35 / 1.61 / 1.65 / 1.58 / 1.13 / 1.36
16.1062,Ethanol Amine / 1.26 / 1.45 / 1.51 / 1.61 / 1.53 / 2.26 / 2.08 / 2.65 / 1.45 / 1.36 / 1.14 / 1.45
16.5375,Unknown / 0.93 / 0.93 / 0.92 / 0.86 / 0.94 / 1.05 / 0.78 / 1.19 / 1.29 / 1.11 / 0.64 / 0.71
17.0069,L-Serine / 1.18 / 1.79 / 5.85 / 5.59 / 1.59 / 1.65 / 3.10 / 0.73 / 0.58 / 1.30 / 18.85 / 17.15
17.0109,Unknown / 1.18 / 1.79 / 5.85 / 5.59 / 1.66 / 1.65 / 3.10 / 0.73 / 0.58 / 1.30 / 18.85 / 17.15
17.0699,Unknown / 0.89 / 0.77 / 1.06 / 0.81 / 0.77 / 1.18 / 0.85 / 1.14 / 0.50 / 1.00 / 1.40 / 2.24
17.1194,Phosphoric Acid / 0.68 / 0.80 / 0.99 / 1.09 / 0.69 / 0.72 / 0.58 / 0.88 / 0.43 / 0.26 / 1.75 / 0.94
17.1249,Glycerol / 0.64 / 0.83 / 1.10 / 1.28 / 0.72 / 0.69 / 0.70 / 0.89 / 0.36 / 0.35 / 2.51 / 0.97
18.1748,Glycine / 0.65 / 0.53 / 0.77 / 0.71 / 0.48 / 1.31 / 0.95 / 1.98 / 0.25 / 2.27 / 1.59 / 4.17
18.3599,Succinic Acid / 0.67 / 0.35 / 0.61 / 0.20 / 0.34 / 0.29 / 0.29 / 0.29 / 0.47 / 3.24 / 3.86 / 2.36
18.6509,L-Proline / 0.68 / 0.74 / 0.88 / 0.86 / 0.46 / 0.46 / 0.57 / 1.29 / 1.52 / 15.05 / 14.26 / 15.71
18.6577,Unknown / 0.70 / 0.45 / 0.49 / 0.45 / 0.81 / 0.41 / 0.80 / 0.51 / 0.75 / 0.56 / 1.28 / 1.00
18.6882,Unknown / 0.85 / 0.53 / 0.42 / 0.38 / 0.42 / 0.37 / 0.34 / 0.47 / 0.41 / 0.55 / 0.51 / 0.51
18.9256,Unknown / 1.75 / 1.55 / 2.11 / 1.62 / 1.80 / 2.10 / 2.70 / 3.74 / 7.17 / 14.20 / 17.76 / 25.05
18.9283,Unknown / 1.44 / 1.45 / 1.87 / 1.47 / 1.55 / 2.01 / 2.35 / 3.49 / 5.98 / 11.75 / 15.03 / 21.25
19.0225,Uracil / 0.41 / 0.53 / 0.76 / 1.29 / 0.89 / 0.87 / 0.65 / 0.90 / 2.37 / 15.39 / 50.54 / 33.16
19.3332,Fumaric Acid / 0.87 / 0.66 / 1.01 / 0.53 / 0.44 / 0.40 / 0.32 / 0.53 / 0.29 / 0.87 / 0.85 / 0.58
19.6248,Unknown / 1.30 / 1.13 / 1.69 / 1.05 / 1.82 / 1.68 / 1.22 / 1.72 / 2.05 / 4.45 / 3.75 / 3.02
19.6289,L-Alanine / 1.12 / 1.00 / 1.59 / 1.07 / 1.65 / 1.53 / 1.26 / 1.55 / 1.86 / 3.99 / 3.20 / 2.56
20.6333,Unknown / 1.08 / 1.17 / 2.10 / 1.27 / 1.11 / 0.88 / 0.39 / 0.75 / 0.77 / 4.68 / 4.54 / 3.59
20.6428,Unknown / 1.21 / 1.31 / 2.33 / 1.42 / 1.24 / 0.98 / 0.44 / 0.84 / 0.85 / 5.20 / 5.05 / 3.99
21.3387,Unknown / 0.76 / 0.85 / 2.99 / 1.84 / 1.84 / 0.63 / 2.67 / 2.75 / 6.31 / 13.39 / 36.85 / 24.47
21.3848,L-Aspartic Acid / 1.51 / 2.19 / 3.02 / 1.89 / 1.96 / 2.56 / 1.52 / 1.73 / 1.25 / 4.97 / 8.83 / 14.18
22.4361,Citramalic Acid / 0.83 / 0.63 / 1.01 / 0.69 / 0.61 / 0.57 / 0.70 / 0.88 / 0.76 / 2.66 / 3.27 / 1.69
22.7955,Malic Acid / 0.85 / 0.48 / 0.49 / 0.36 / 0.31 / 0.31 / 0.28 / 0.30 / 0.13 / 0.15 / 0.16 / 0.10
23.1957,Unknown / 0.86 / 0.70 / 0.90 / 0.65 / 0.67 / 0.77 / 0.69 / 0.82 / 0.59 / 0.53 / 0.81 / 0.61
23.2635,L-Leucine / 1.11 / 1.43 / 2.36 / 2.02 / 2.47 / 2.15 / 2.74 / 2.42 / 5.85 / 6.95 / 10.38 / 7.50
23.3394,Undecanoic Acid / 1.45 / 1.11 / 1.39 / 1.33 / 0.89 / 0.95 / 0.78 / 1.80 / 0.90 / 1.02 / 566.7 / 463.8
23.6121,L-Aspartic Acid / 0.79 / 0.72 / 0.72 / 0.78 / 0.66 / 0.39 / 0.68 / 0.47 / 0.44 / 0.53 / 23.99 / 16.32
23.6148,Unknown / 0.24 / 0.23 / 5.69 / 5.97 / 3.14 / 0.85 / 1.62 / 0.83 / 2.92 / 3.73 / 358.7 / 246.5
23.6996,Unknown / 0.55 / 0.51 / 0.72 / 0.67 / 0.31 / 0.36 / 0.48 / 0.49 / 0.38 / 0.40 / 3.52 / 2.17
23.7925,Pyroglutamic Acid / 0.56 / 1.08 / 2.05 / 1.52 / 0.49 / 0.97 / 0.72 / 0.76 / 0.19 / 0.30 / 1.16 / 0.89
23.9566,Unknown / 0.66 / 0.68 / 1.59 / 0.75 / 0.73 / 1.15 / 0.74 / 1.28 / 0.18 / 0.33 / 0.28 / 0.74
24.0699,Unknown / 0.83 / 0.53 / 0.37 / 0.42 / 0.44 / 0.39 / 0.40 / 0.46 / 0.65 / 1.40 / 1.37 / 1.70
24.1458,Unknown / 0.91 / 0.66 / 0.77 / 0.71 / 0.59 / 1.51 / 0.89 / 0.68 / 0.38 / 1.07 / 0.66 / 0.61
24.4639,Trihydroxybutyric Acid / 1.59 / 0.81 / 0.36 / 0.39 / 0.59 / 0.42 / 0.38 / 0.30 / 0.43 / 0.71 / 0.43 / 0.57
24.9041,L-Serine / 1.44 / 1.41 / 2.34 / 1.74 / 2.64 / 2.83 / 2.54 / 2.98 / 3.00 / 2.81 / 5.78 / 6.70
24.9245,Unknown / 0.75 / 0.91 / 1.49 / 1.03 / 1.13 / 0.71 / 1.00 / 1.25 / 0.66 / 1.82 / 7.40 / 6.16
24.9672,Alpha-Ketoglutaric Acid / 0.25 / 0.36 / 0.50 / 0.19 / 0.14 / 0.16 / 0.22 / 0.31 / 0.08 / 0.77 / 6.84 / 2.90
25.2249,Unknown / 0.31 / 0.41 / 0.67 / 0.34 / 0.21 / 0.36 / 0.22 / 0.24 / 0.15 / 0.20 / 0.29 / 0.26
25.2303,Unknown / 0.31 / 0.41 / 0.67 / 0.34 / 0.21 / 0.36 / 0.22 / 0.24 / 0.15 / 0.20 / 0.29 / 0.26
25.2371,Unknown / 0.31 / 0.37 / 0.66 / 0.32 / 0.16 / 0.32 / 0.17 / 0.22 / 0.14 / 0.20 / 0.28 / 0.22
25.4413,Unknown / 1.82 / 1.67 / 1.32 / 0.55 / 1.28 / 1.11 / 0.71 / 1.32 / 1.09 / 2.93 / 6.00 / 8.58
25.4535,Unknown / 1.76 / 1.24 / 0.77 / 0.43 / 0.94 / 0.58 / 0.44 / 0.53 / 0.41 / 2.67 / 4.90 / 7.38
25.5844,Unknown / 1.39 / 3.09 / 2.80 / 2.90 / 0.69 / 0.75 / 2.86 / 3.32 / 1.56 / 3.57 / 11.92 / 18.56
25.8285,Phosphoric Acid / 0.91 / 1.68 / 2.64 / 1.58 / 1.96 / 3.51 / 2.93 / 2.84 / 1.80 / 1.78 / 84.04 / 91.20
26.1595,Unknown / 0.94 / 1.10 / 1.00 / 1.11 / 0.94 / 1.27 / 1.08 / 1.39 / 1.53 / 1.61 / 2.08 / 1.68
26.2341,Unknown / 0.59 / 0.55 / 1.08 / 0.47 / 0.61 / 0.63 / 1.00 / 0.78 / 4.92 / 2.92 / 3.79 / 4.50
26.3094,L-Phenylalanine / 0.95 / 1.21 / 0.89 / 0.89 / 3.25 / 2.44 / 0.89 / 1.62 / 1.12 / 1.48 / 123.3 / 82.09
26.6892,Unknown / 0.65 / 1.01 / 0.80 / 0.56 / 1.14 / 0.72 / 0.74 / 0.70 / 0.86 / 2.20 / 2.20 / 1.55
26.9808,Unknown / 1.01 / 1.38 / 0.87 / 0.50 / 0.76 / 0.88 / 1.07 / 0.34 / 0.48 / 18.03 / 61.61 / 39.59
27.1918,D-(-)-Ribose / 0.80 / 0.57 / 0.72 / 0.61 / 0.68 / 0.72 / 0.59 / 0.78 / 0.76 / 5.92 / 17.02 / 11.97
27.284,Unknown / 0.78 / 0.63 / 0.56 / 0.48 / 1.06 / 0.45 / 0.86 / 0.33 / 0.46 / 2.59 / 6.09 / 3.70
27.3003,L-Threonine / 1.01 / 1.09 / 1.62 / 1.21 / 1.60 / 2.01 / 1.97 / 2.43 / 3.44 / 4.01 / 5.28 / 3.97
27.4359,Unknown / 0.42 / 1.08 / 3.23 / 2.72 / 0.66 / 1.87 / 1.57 / 2.89 / 0.59 / 1.84 / 9.22 / 10.76
27.6638,Unknown / 1.49 / 0.77 / 1.59 / 1.09 / 1.13 / 0.62 / 0.80 / 0.79 / 0.90 / 1.77 / 3.40 / 2.09
27.834,Unknown / 1.13 / 0.57 / 1.66 / 0.37 / 0.45 / 1.27 / 0.85 / 1.23 / 2.15 / 39.16 / 52.00 / 35.62
27.9236,Unknown / 1.17 / 0.91 / 0.89 / 0.99 / 0.80 / 0.81 / 0.71 / 1.37 / 0.93 / 31.77 / 70.38 / 22.87
28.0267,Unknown / 1.14 / 0.34 / 0.31 / 1.14 / 0.36 / 0.53 / 0.46 / 1.30 / 1.55 / 37.02 / 49.44 / 36.60
28.0287,Unknown / 0.93 / 2.86 / 1.38 / 2.83 / 1.41 / 1.46 / 2.33 / 1.30 / 13.12 / 35.56 / 475.4 / 347.3
28.1691,Unknown / 0.70 / 1.07 / 1.15 / 1.21 / 0.99 / 1.48 / 1.53 / 2.26 / 2.27 / 2.15 / 2.53 / 2.48
28.2708,Unknown / 0.96 / 0.97 / 0.98 / 0.96 / 0.98 / 0.95 / 0.98 / 1.01 / 1.04 / 1.02 / 1.01 / 1.00
28.5475,L-Aspartic Acid / 0.57 / 0.39 / 0.50 / 0.47 / 0.90 / 0.79 / 0.77 / 0.49 / 5.07 / 1.53 / 1.61 / 1.06
29.0833,alpha-glycerophosphate ester / 1.69 / 1.42 / 1.28 / 1.01 / 1.67 / 2.05 / 1.67 / 2.74 / 0.64 / 0.70 / 9.31 / 6.02
29.1037,Tartaric Acid / 0.67 / 0.37 / 0.37 / 0.27 / 0.36 / 0.34 / 0.24 / 0.20 / 0.30 / 0.88 / 1.48 / 0.68
29.2597,Unknown / 0.95 / 1.23 / 1.21 / 1.41 / 1.26 / 1.79 / 1.67 / 2.21 / 1.57 / 0.59 / 0.46 / 0.70
29.3071,Unknown / 0.86 / 1.10 / 1.07 / 1.35 / 1.18 / 1.69 / 1.68 / 2.10 / 1.52 / 0.52 / 0.41 / 0.62
29.4564,Unknown / 0.39 / 0.26 / 0.29 / 0.13 / 0.29 / 0.17 / 0.08 / 0.11 / 0.06 / 0.34 / 0.37 / 0.28
29.4672,Unknown / 0.78 / 0.39 / 0.28 / 0.13 / 0.72 / 0.18 / 0.24 / 0.25 / 0.21 / 2.54 / 3.32 / 1.44
29.5927,Unknown / 0.63 / 0.27 / 0.78 / 0.79 / 0.34 / 0.57 / 0.77 / 1.04 / 0.43 / 1.12 / 5.10 / 3.85
29.6571,Unknown / 0.89 / 0.78 / 0.73 / 0.60 / 0.61 / 0.81 / 0.70 / 1.07 / 1.52 / 0.48 / 0.39 / 0.44
29.7588,Unknown / 1.24 / 1.41 / 1.76 / 0.88 / 1.40 / 0.93 / 1.15 / 1.50 / 0.61 / 2.31 / 8.07 / 4.28
29.8897,Unknown / 0.41 / 0.50 / 0.96 / 0.45 / 0.40 / 0.43 / 0.63 / 0.82 / 0.35 / 1.55 / 8.60 / 5.55
30.1203,Shikimic Acid / 0.62 / 0.48 / 0.36 / 0.39 / 0.35 / 0.32 / 0.28 / 0.33 / 0.35 / 0.34 / 0.53 / 0.48
30.296,Unknown / 1.24 / 2.77 / 6.35 / 6.31 / 1.19 / 1.69 / 3.27 / 5.43 / 1.74 / 2.64 / 6.96 / 7.81
30.3747,Unknown / 1.08 / 1.01 / 1.50 / 1.09 / 0.81 / 0.87 / 0.97 / 1.14 / 0.49 / 3.63 / 12.48 / 6.68
30.3814,Unknown / 1.26 / 1.12 / 1.90 / 1.28 / 0.92 / 0.91 / 1.06 / 1.33 / 0.71 / 5.46 / 20.41 / 10.54
30.3889,Citric Acid / 1.26 / 1.12 / 1.90 / 1.28 / 0.92 / 0.91 / 1.06 / 1.33 / 0.71 / 5.46 / 20.41 / 10.54
30.4913,3,4-Dihydroxybenzoic acid / 1.09 / 1.88 / 0.77 / 0.74 / 1.15 / 1.63 / 0.88 / 1.60 / 0.37 / 0.64 / 2.95 / 2.26
30.5008,Unknown / 1.25 / 0.81 / 0.88 / 1.23 / 0.68 / 1.38 / 0.98 / 1.31 / 1.23 / 3.07 / 30.77 / 18.06
30.9145,L-Asparagine / 0.54 / 0.56 / 1.08 / 1.95 / 0.31 / 0.19 / 0.41 / 0.35 / 0.43 / 0.56 / 13.51 / 11.34
31.0298,Unknown / 0.73 / 0.64 / 1.05 / 0.54 / 0.78 / 0.61 / 0.61 / 0.63 / 2.16 / 2.15 / 4.48 / 2.27
31.1397,Quinic Acid / 0.69 / 0.55 / 0.65 / 0.59 / 0.64 / 0.53 / 0.54 / 0.56 / 0.39 / 1.14 / 2.00 / 1.85
31.1431,Unknown / 0.70 / 0.57 / 0.67 / 0.59 / 0.61 / 0.58 / 0.55 / 0.50 / 0.37 / 1.08 / 1.94 / 1.74
31.1648,Unknown / 0.71 / 0.67 / 0.88 / 0.68 / 0.67 / 0.55 / 0.44 / 0.65 / 0.42 / 0.72 / 2.97 / 1.99
31.276,Unknown / 0.87 / 1.29 / 1.62 / 0.95 / 3.29 / 0.93 / 0.92 / 1.45 / 11.42 / 0.76 / 1.31 / 1.24
31.2855,Unknown / 0.13 / 0.20 / 0.25 / 0.51 / 1.52 / 0.14 / 0.14 / 0.61 / 1.73 / 0.15 / 0.20 / 0.29
31.3669,Unknown / 0.61 / 0.47 / 0.67 / 0.48 / 0.66 / 0.45 / 0.48 / 0.65 / 0.75 / 0.11 / 0.11 / 0.15
31.3744,D-Psicose / 0.57 / 0.45 / 0.70 / 0.45 / 0.64 / 0.40 / 0.48 / 0.64 / 0.75 / 0.10 / 0.08 / 0.12
31.4951,L-Asparagine / 1.23 / 0.77 / 5.11 / 6.39 / 0.57 / 0.20 / 0.82 / 0.80 / 0.71 / 0.45 / 350.8 / 183.0
31.5229,D-(-)-Fructose / 0.62 / 0.53 / 0.66 / 0.51 / 0.65 / 0.50 / 0.50 / 0.64 / 0.71 / 0.23 / 0.55 / 0.35
31.7745,L-Phenylalanine / 1.17 / 0.40 / 0.75 / 0.65 / 0.80 / 0.61 / 0.53 / 0.31 / 1.24 / 2.00 / 3.95 / 2.87
31.7888,D-(+)-Galactose / 1.12 / 0.33 / 0.39 / 0.31 / 0.59 / 0.36 / 0.34 / 0.32 / 0.43 / 0.59 / 1.26 / 0.53
31.9102,D-(+)-Mannose / 0.65 / 0.43 / 0.65 / 0.48 / 0.63 / 0.39 / 0.47 / 0.56 / 0.46 / 0.15 / 0.33 / 0.17
31.9441,Unknown / 0.35 / 0.94 / 1.40 / 2.94 / 0.46 / 1.98 / 3.31 / 3.28 / 0.50 / 1.38 / 12.51 / 4.83
32.0614,Unknown / 0.52 / 0.33 / 0.45 / 0.25 / 0.32 / 0.38 / 0.73 / 0.26 / 0.20 / 0.29 / 0.61 / 0.63
32.2574,D-(+)-Mannose / 0.54 / 0.26 / 0.36 / 0.29 / 0.27 / 0.35 / 0.29 / 0.47 / 0.22 / 0.08 / 0.21 / 0.17
32.507,Tyramine / 7.57 / 5.39 / 5.00 / 1.06 / 2.19 / 4.01 / 4.14 / 3.87 / 0.73 / 7.82 / 435.9 / 212.9
32.6582,n-Octyl-beta-D-glucoside / 0.50 / 0.38 / 0.59 / 0.54 / 0.33 / 0.42 / 0.55 / 1.54 / 0.23 / 0.87 / 2.30 / 1.65
32.9085,Unknown / 1.14 / 1.40 / 3.70 / 2.35 / 0.73 / 0.95 / 0.99 / 3.23 / 1.48 / 3.95 / 28.31 / 18.64
32.9126,Unknown / 1.32 / 1.05 / 3.85 / 3.38 / 0.96 / 0.98 / 1.02 / 2.99 / 1.23 / 5.09 / 33.44 / 20.30
33.3114,Unknown / 0.74 / 0.48 / 0.26 / 0.87 / 0.12 / 0.22 / 0.47 / 0.66 / 0.30 / 0.83 / 1.25 / 0.93
33.9733,Unknown / 0.60 / 0.53 / 0.23 / 0.24 / 0.18 / 0.34 / 0.49 / 0.17 / 0.57 / 0.98 / 2.45 / 3.14
34.2392,Unknown / 1.05 / 0.34 / 0.52 / 0.23 / 0.58 / 0.56 / 0.93 / 0.51 / 0.44 / 1.11 / 1.37 / 1.53
34.2555,Unknown / 1.30 / 0.44 / 0.73 / 0.30 / 0.75 / 0.72 / 1.20 / 0.66 / 0.63 / 1.43 / 1.77 / 1.97
34.5227,Unknown / 0.68 / 0.28 / 0.29 / 0.17 / 0.28 / 0.19 / 0.15 / 0.12 / 0.29 / 0.39 / 0.59 / 0.34
35.1005,Unknown / 1.24 / 0.94 / 0.97 / 0.93 / 0.99 / 1.23 / 1.09 / 1.55 / 0.72 / 0.53 / 0.69 / 0.70
35.5889,Unknown / 0.85 / 0.34 / 0.64 / 0.62 / 0.53 / 0.83 / 0.79 / 0.60 / 0.30 / 0.42 / 1.90 / 1.31
35.7401,Myo-Inositol / 0.79 / 0.41 / 0.29 / 0.26 / 0.44 / 0.44 / 0.33 / 0.25 / 0.35 / 0.36 / 0.31 / 0.22
36.0283,D-(+)-Galactose / 0.85 / 0.51 / 0.74 / 0.45 / 0.59 / 0.47 / 0.53 / 0.48 / 0.63 / 1.81 / 3.90 / 1.68
36.088,Unknown / 0.97 / 1.00 / 0.92 / 1.07 / 0.97 / 1.11 / 1.20 / 1.51 / 0.98 / 0.86 / 1.04 / 0.98
36.1599,Unknown / 0.65 / 0.83 / 0.51 / 0.26 / 0.37 / 0.93 / 0.42 / 1.16 / 0.45 / 0.66 / 7.60 / 2.64
36.1701,Unknown / 1.55 / 1.32 / 0.65 / 0.51 / 0.68 / 0.85 / 0.63 / 0.56 / 0.02 / 0.05 / 1.32 / 0.38
36.5797,Unknown / 0.65 / 0.69 / 0.71 / 1.08 / 1.02 / 0.85 / 1.25 / 1.06 / 1.24 / 0.96 / 0.81 / 0.81
36.7391,Unknown / 0.83 / 0.25 / 0.37 / 0.32 / 0.22 / 0.47 / 0.64 / 0.89 / 0.06 / 0.27 / 7.07 / 1.78
36.7981,L-Lysine / 1.42 / 0.93 / 0.94 / 0.81 / 0.99 / 1.13 / 0.61 / 1.75 / 0.59 / 0.49 / 74.41 / 8.99
36.9589,Unknown / 0.18 / 0.47 / 0.45 / 0.23 / 0.34 / 0.89 / 0.51 / 0.76 / 0.13 / 0.49 / 2.59 / 0.97
37.1406,Unknown / 0.73 / 0.67 / 0.60 / 0.59 / 0.38 / 0.58 / 0.59 / 1.08 / 0.43 / 0.31 / 0.38 / 0.28
37.161,Unknown / 0.94 / 0.81 / 0.59 / 0.73 / 0.42 / 0.65 / 0.58 / 0.83 / 0.81 / 0.34 / 0.48 / 0.21
37.1739,Unknown / 2.37 / 0.68 / 0.52 / 0.90 / 0.37 / 0.81 / 0.47 / 1.70 / 0.19 / 0.28 / 0.63 / 0.79
37.5638,L-Tyrosine / 0.88 / 1.61 / 2.78 / 1.36 / 1.07 / 0.61 / 1.40 / 1.64 / 1.93 / 2.59 / 41.33 / 16.54
37.5679,Unknown / 1.08 / 0.58 / 0.75 / 2.15 / 1.67 / 0.87 / 3.98 / 1.01 / 1.44 / 0.59 / 12.64 / 4.33
37.6357,Unknown / 1.35 / 0.66 / 2.10 / 1.76 / 0.56 / 0.90 / 1.19 / 1.63 / 0.35 / 0.37 / 6.90 / 4.84
39.2296,Unknown / 0.52 / 0.34 / 0.83 / 0.50 / 0.18 / 0.20 / 0.41 / 0.43 / 0.11 / 0.19 / 2.75 / 1.21
39.5348,galactosyl glycerol / 1.18 / 0.24 / 0.26 / 0.14 / 0.29 / 0.28 / 0.11 / 0.24 / 0.80 / 3.07 / 29.82 / 20.15
40.5338,Unknown / 0.68 / 0.57 / 0.53 / 0.51 / 0.28 / 0.49 / 0.46 / 0.41 / 0.12 / 0.24 / 1.97 / 0.99
42.1276,L-Tryptophan / 0.68 / 1.93 / 0.88 / 0.69 / 0.36 / 1.28 / 0.49 / 0.92 / 0.50 / 0.69 / 18.01 / 6.80
43.7764,Unknown / 2.01 / 0.52 / 1.48 / 0.37 / 0.41 / 0.42 / 1.33 / 0.54 / 0.27 / 0.15 / 0.83 / 0.83
43.7866,Unknown / 0.26 / 0.61 / 0.34 / 0.44 / 0.37 / 0.87 / 0.58 / 0.43 / 0.15 / 0.18 / 0.21 / 0.17
44.5489,Unknown / 0.74 / 0.71 / 0.78 / 0.65 / 0.35 / 0.61 / 0.48 / 0.46 / 0.18 / 0.31 / 0.33 / 0.29
46.2655,Trehalose / 0.61 / 0.38 / 0.40 / 0.50 / 0.28 / 0.37 / 0.27 / 0.33 / 0.15 / 1.32 / 14.34 / 6.71
46.5367,Unknown / 0.59 / 0.33 / 0.25 / 0.45 / 0.26 / 0.20 / 0.15 / 0.32 / 0.07 / 0.25 / 2.87 / 0.93
49.7563,Unknown / 0.76 / 0.55 / 0.69 / 0.52 / 0.34 / 0.42 / 0.42 / 0.49 / 0.26 / 0.37 / 2.48 / 1.35
51.521,Unknown / 0.32 / 0.37 / 0.26 / 0.34 / 0.29 / 0.25 / 0.32 / 0.42 / 0.08 / 0.12 / 9.26 / 0.30
54.1471,Unknown / 0.70 / 0.88 / 0.89 / 0.59 / 0.48 / 0.84 / 0.91 / 0.48 / 0.19 / 0.31 / 0.34 / 0.35