Pöyry, T.A.A., Kaminski, A. and Jackson R.J.: Supplemental Material

Pöyry, T.A.A., Kaminski, A. and Jackson R.J.: Supplemental Material

MATERIALS AND METHODS

Plasmid construction

The CAT reporter was originally cloned in pSP73 (Promega) and the construct then modified in two ways. First, an 85 residue poly(A) tract was inserted between the SmaI and BglII sites. Also, the unique internal NcoI site near the distal end of the CAT ORF was destroyed by cutting and in-filling. As a consequence of the resulting frame-shift, the CAT ORF used in these studies is 22 codons shorter than the wild type, and its last 24 codons differ from wild type.

Conversion of the CAT ORF to TPI-CAT fusion constructs, with or without a premature stop codon, was achieved by PCR using oligonucleotides : norm-sense (5’-GGGGCTCGAGGATATCCCATGGCGCCC TCCAGG-3’) and 2ter-sense (5’- GGGGCTCGAGGATATCCCATGGCGTAGTCCAGG-3’) having a XhoI (italics), EcoRV (italics and underlined) and NcoI (italics and double underline) sites; and an antisense primer spanning the internal EcoRI site in the CAT ORF. The primer pairs were used to amplify a ~350 bp fragment from, respectively, pMT-CAT-norm or pMT-CAT-2ter (Zhang and Maquat 1997) as template. The PCR fragments were digested with XhoI and EcoRI and cloned between XhoI and EcoRI sites in the modified pSP73-CAT to produce pSP73-(XhoI-EcoRV-NcoI)-TPI-CAT/norm and pSP73-(XhoI-EcoRV-NcoI)-TPI-CAT/2ter.

The TPI 5’UTR was excised from the pMT-CAT-norm by cutting it first with XmaI followed by in-filling the overhanging ends, then with NcoI. This was cloned into EcoRV and NcoI cut pSP73-(XhoI-EcoRV-NcoI)-TPI-CAT/norm and pSP73-(XhoI-EcoRV-NcoI)-TPI-CAT/2ter, to produce TPI/norm and TPI/2ter, respectively, which encode a 5’-UTR consisting of 25 nt. residual polylinker followed by 43 nt. of TPI 5’-UTR.

The EMCV IRES (R strain, nt 286-833) was amplified by PCR from pEMCV L-VP0-(6A) (Kaminski and Jackson 1998) as template, and the HRV-2 IRES (nt. 15-610) was amplified from pJHRV 10-610 (Borman and Jackson 1992). In both cases the sense primers included a XhoI site and the antisense primers an NcoI site at the initiation codon. The PCR products were digested with XhoI and NcoI, and cloned into XhoI and NcoI cut pSP73-(XhoI-EcoRV-NcoI)-TPI-CAT/norm and pSP73-(XhoI-EcoRV-NcoI)-TPI-CAT/2ter, to generate EMCV/norm, EMCV/2ter, HRV/norm, and HRV/2ter. CSFV/norm and CSFV/2ter were made in a similar way, by cutting the CSFV IRES (nt. 1-372) with SalI and NcoI from the C/Cs cDNA construct described by Fletcher et al. (2002), and cloning the fragment between the XhoI and NcoI sites of each pSP73 construct. With all three pairs of IRES-containing constructs the initiation codon of the TPI-CAT fusion is in the precise position of the viral initiation codon, but the introduction of the NcoI site has changed the context of the EMCV initiation codon from wild type AUAAUG to ACCAUG, and the CSFV initiation codon from CACAUG to CCCAUG (with no change in the HRV initiation codon context).

The CrPV intergenic IRES (nt 6025-6232) was obtained from pGEM3-CrPV-Luc (Wilson et al. 2000) by cutting first with EcoRI and in-filling the overhanging ends, then with NcoI and cloning the 220 nt fragment into EcoRV and NcoI cut pSP73-(XhoI-EcoRV-NcoI)-TPI-CAT/norm and pSP73-(XhoI-EcoRV-NcoI)-TPI-CAT/2ter, to produce CrPV/+8norm and CrPV/8ter, respectively. This cloning resulted in the inclusion of an extra 6 amino acids from CrPV ORF2 (Fig. 1b).

The 5’UTR consisting essentially of 19 tandem CAA triplets was made using two pairs of overlapping oligonucleotides. The first pair: (sense) 5’ – TCGAGATATCGTTAACCT GGCTTATCGAAATTAATACGACTCACTATAGCAAGAACAA – 3’ and (antisense) 5’- GTTGTTGTTCTTGCTATAGTGAGTCGTATTAATTTCGATAAGCCAGGTTAACGATATC-3’ had a T7 promoter (underlined) flanked by a HpaI site (italics) and a XhoI overhang (italics and underlined). The second pair: (sense) 5’- (CAA)18-CAC-3’ and (antisense) 5’- CATGGTG-(TTG)16-TT -3’ had a NcoI overhang (italics and underlined). The two pairs were annealed individually, then combined together, ligated and cloned into XhoI and NcoI cut pSP73-(XhoI-EcoRV-NcoI)-TPI-CAT/norm to produce 2xT7-(CAA)19/norm. This construct was digested with HpaI to remove the upstream T7 promoter and religated to produce (CAA)19/norm. An NcoI – EcoRI fragment was cut from TPI/2ter and cloned between the NcoI and EcoRI sites in (CAA)19/norm to produce (CAA)19/2ter. The outcome of this cloning is to remove all residual polylinker sequences, so that the 5’-UTR sequence will be 5’-GCAAGAA(CAA)19CACC(AUG)-3’.

The extension of the short upstream ORF by 8 codons (Fig. 1) was done by inserting synthetic oligonucleotides into the NcoI site of both TPI-constructs, both EMCV IRES constructs, both CSFV IRES constructs, and both (CAA)19 constructs, to generate, respectively: TPI/+8norm and TPI/2+8ter; EMCV/+8norm and EMCV/2+8ter; CSFV/+8norm and CSFV/2+8ter ; and (CAA)19/+8norm and (CAA)19/2+8ter.

All constructs were verified by DNA sequencing.

REFERENCES

Borman, A. and Jackson, R.J. 1992. Initiation of translation of human rhinovirus RNA: mapping the internal ribosome entry site. Virology 188: 685-696.

Fletcher, S.P., Ali, I.K., Kaminski, A., Digard, P., and Jackson, R.J. 2002. The influence of viral coding sequences on pestivirus IRES activity reveals further parallels with translation initiation in prokaryotes. RNA 8: 1558-1571.

Kaminski, A. and Jackson, R.J. 1998. The polypyrimidine tract binding protein (PTB) requirement for internal initiation of translation of cardiovirus RNAs is conditional rather than absolute. RNA 4: 626-638.

Wilson J.E., Pestova, T.V., Hellen, C.U.T., and Sarnow, P. 2000. Initiation of protein synthesis from the A site of the ribosome. Cell 123: 511-520.

Zhang, J. and Maquat, L.E. 1997. Evidence that translation reinitiation abrogates nonsense-mediated mRNA decay in mammalian cells. EMBO J. 16: 826-833.

4