ONLINE ONLY APPENDIX

ONLINE ONLY RESEARCH DESIGN AND METHODS

Immunoblotting

MIN6 cells (3 x105 cells/ml) were treated with AMD3100 (Sigma-Aldrich, Inc., St. Louis, MO), streptozotocin (STZ) (Sigma-Aldrich, Inc., St. Louis, MO), mouse anti-CXCR4 monoclonal antibody (12G5, R&D Systems, Inc. Minneapolis, MN), and respective vehicle controls for the times indicated. STZ was dissolved in 50 mM sodium citrate buffer (pH4.7). Cell lysates were prepared using ice-cold RIPA buffer (50 mM Tris-HCl, NaF, sodium vanadate, pH7.4) and further clarified by brief sonication and microcentrifugation. Samples were heated for 5 min at 95oC after addition of SDS sample buffer (Invitrogen Corp., Carlsbad, CA) and subjected to electrophoresis on NuPAGE gels (Invitrogen Corp., Carlsbad, CA). Proteins separated by electrophoresis were transferred to nitrocellulose filters (0.45 mM, Osmonics, Inc., Minnetonka, MN). The filters were blocked by incubating with 5% skim milk for 1 h, and incubated with primary antibodies overnight at 4oC. After a 30-min incubation with horseradish peroxidase-labeled secondary antibodies, proteins were observed with ECL Western blotting detection reagents (Amersham Biosciences, Piscataway, NJ). Protein density was quantified by densitometric analysis using a Kodak Image Station 440 CF (Eastman Kodak Co., Rochester, NY). Primary antibodies used were (Cell Signaling Technologies Inc., Beverly, MA,) Phospho-Akt (Ser473) (587F11) Monoclonal (#4051), Akt, recognizing Akt1, 2, and 3 (#9272), Phospho-p44/42 MAP Kinase (Thr202/Tyr204) (#9101), p44/42 MAP Kinase (#9102), Bcl-xL (54H6) (#2764), Bax (#2772), and Phospho-Bad (Ser136) Antibody (#9295); (SantaCruz Biotechnology, Santa Cruz, CA), Bcl-2 (N-19) (sc-492), Bad (C-7) (sc-8044), and Actin (C-11) Antibody (sc-1615).

Immunostaining

Pancreata were dissected and fixed with unbuffered formaldehyde solution and embedded in paraffin. Sections were stained with guinea-pig anti-insulin (Linco Research, Inc., St. Charles, MD), mouse anti-glucagon (Linco Research, Inc. St. Charles, MD), sheep anti-somatostatin (Cortex Biochem, Inc. San Leandro, CA), anti-human/mouse SDF-1 monoclonal antibody (MAB310, R&D Systems) and goat anti SDF-1 polyclonal antibody (sc-6193, SantaCruz). For detection of SDF-1 on paraffin-embedded sections, antigens were unmasked by microwaving the slides in 10mM EDTA buffer (pH8.0). To detect endothelial cells, the sections were stained with 20 mg/ml of biotinylated Bandeiraea simplicifolia lectin BS-1 (BS-1 lectin) (L3759, Sigma-Aldrich, Inc., St. Louis, MO)(31), after antigen retrieval by treating the sections overnight with 0.1 U/ml Neuraminidase V (N2876, Sigma-Aldrich, Inc., St. Louis, MO) in 100 mM sodium acetate buffer (pH5.0) at 37oC. For preparation of frozen sections, pancreata were frozen in OCT compound embedding medium (Sakura Finetek U.S.A. Inc., Torrance, CA) and sliced into 5 micron sections. Prior to staining, the frozen sections were fixed with 4% paraformaldehyde. Sections were costained with antibodies for hormones and SDF-1 using detection methods as described above, and withrabbit anti-phospho-Akt (Ser473) antibody (#4051 and #3787, Cell Signaling Technologies Inc.), goat anti-mouse CXCR4 (Capralogics, Inc., Hardwick, MA), mouse anti-alpha smooth muscle actin, and fluorescein Dolichos Biflorus aggulutinin (DBA) (FL-1031, Vector Laboratories, Inc. Burlingame, CA). Primary antibodies were visualized with Cy2, Cy3, and Cy5-labeled secondary antibodies and avidin (Jackson Immunoresearch Laboratories, Inc. West Grove, PA). Images were taken in black and white with a CCD camera attached to a fluorescent microscope and analyzed with IP-Lab and Adobe Photoshop software.

RT-PCR

Total mRNA was prepared from mouse islets, INS-1, or MIN6 cells after the indicated treatments using SuperScript II reverse transcriptase (Invitrogen Corp., Carlsbad, CA). To amplify the cDNAs, PCR was carried out using TaKaRa recombinant Taq polymerase and the following primers; mouse actin, forward5'-TGTTTGAGACCTTCAACACC-3' and reverse 5'-CCAGACAGCACTGTGTTGGC-3'; mouse SDF-1, forward 5'-CGCCAGAGCCAACGTCAAG-3' and reverse 5'-CTTGTTTTAAAGCTTTCTCCAGGTAC-3'; mouse CXCR4, forward 5'-AGCTGTTGGCTGAAAAGCTGGTCTATG-3' and reverse 5'-GCGCTTCTGGTGGCCCTTGGAGTGTG-3', with 40 cycles of amplification at 94oC for 30sec, 55oC for 30sec, and 72oC for 1min. DNA fragments were analyzed by electrophoresis on 1.5% agarose gels.

Measurement of cell growth

The growth of MIN6 cells was determined by measuring the DNA content of the cells after culture for 6 days in the presence or absence of inhibitors of CXCR4. Cells were scraped from the plates, sonicated, and DNA content was measured with the CyQUANT cell proliferation assay kit (Molecular Probes, Inc., Eugene, OR).

Apoptosis assays

Apoptotic cells were detected using In Situ Cell Death Detection kits (Roche Diagnostics, Indianapolis, IN) on frozen pancreas sections and MIN6 cells, using a modified version of the manufacturer's protocol (63). The sections were counterstained with DAPI and anti-Insulin antibody. Images were taken and analyzed as described above. DNA ladders of MIN6 cells were analyzed with the ApoTarget DNA ladder detection kit (BioSource International Inc., Camarillo, CA). Reactive oxygen species (ROS) were measured using 5-(and-6)-chloromethyl-2’,7’-dichlorodihydrofluorescein diacetate acetyl ester (CM-H2DCFDA) (Molecular Probes Inc., Eugene, OR).

MIN6 cells (3 x 105 cells/ml) were cultured in 96-well plates and treated with AMD3100 (10 microM), 12G5 monoclonal antibody (12.5 mg/ml), STZ (5mM), and vehicle as controls. The culture media in the AMD3100 experiments contained 15% serum, whereas, serum free media was used for the 12G5 experiments. Cells were washed twice with pre-warmed serum free DMEM medium, followed by the addition of fresh serum free DMEM medium containing 2 mM of CM-H2DCFDA. The fluorescence of each well (0-time value) was measured with a fluorometer VICTOR2 (Perkin-Elmer Corp., Foster City, CA). The cells were cultured for 1 h, and the fluorescent values of the cells (1 h-time value) were measured again. ROS amounts were estimated by subtracting the 0 from the 1 h-time values. Caspase3 activities in MIN6 cells were measured with the EnzChek Caspase 3 assay kit 2 (Molecular Probes, Inc., Eugene, OR).

For apoptosis assay on cultured cells,INS-1 cells were seeded into 24-well plates (10% FBS and 10 mM glucose) one day before 24 h serum starvation (1% FBS and 10 mM glucose) and then subjected to glucose deprivation (1% FBS and 0 mM glucose) or treatment with 1 mM thapsigargin (1% FBS, 10 mM glucose and 1 mM thapsigargin) for an additional 16 h. In studies examining the anti-apoptotic effects of SDF-1, 10 nM SDF-1 was added concomitantly with glucose-free medium in the presence or absence of thapsigargin. In studies in which Akt inhibitor was used, SH-5 (10 nM) was added concomitantly with SDF-1. In studies in which siRNAs were used, Akt siRNA or scramble siRNA were transfected into INS-1 cells with Lipofectamine 2000 during serum starvation. Following treatment, caspase-3 activity was determined according to the manufacturer’s protocol (Molecular Probes). Caspase-3 activity per well was assessed by using a microplate fluorescence reader (VICTOR3 V™ Multilabel Counter, excitation/emission at 496/520 nm), and normalized for total protein content measured with the BCA protein assay (Pierce, Roxford, IL).

For apoptosis assays on isolated mouse islets, islets were treated with trypsin-EDTA for 10 min. Dispersed islet cells were placed into 24-well plates, treated with 1 microM thapsigargin or 10 mM STZ for 20-24 hours, and incubated at 37 C. In studies examining the anti-apoptotic effects of SDF-1, 10 nM SDF-1 was added concomitantly. In studies in which the Akt inhibitor was used, 10 nM SH-5 was added concomitantly with SDF-1. Following 20-24 hour treatment periods, caspase-3 activity was measured.

siRNA

Akt siRNA and scramble siRNA oligonucleotides were purchased from Cell Signaling Technology, Inc. INS-1 cells were transfected using Lipofectamine 2000 according tothe manufacturer’s recommendations (Invitrogen Corp.).

Real-time PCR

Real-time PCR was performed on a Cepheid Smart-Cycler Thermocycler by using a SYBR Green QPCR kit (Stratagene, La Jolla, CA)according to the manufacturer’s protocol. Briefly, total RNA was prepared from 10-5 transfected INS-1cells and reverse transcribed to cDNA with SuperScript II reverse transcriptase (Invitrogen Corp.). PCR was performed to amplify Akt by using the following primers: forward 5'-GCTCTTCTTCCACCTGTCTC-3' and reverse

5'-GTCCTTGATACCCTCCTTGC-3'. Akt mRNA levels were normalized with GAPDH as a control. PCR was performed to amplify CXCR4 and SDF-1 by using the following primers: mouse CXCR4, forward, agctgttggctgaaaagctggtctatg, reverse, gcgcttctggtggcccttggagtgtg; rat CXCR4, forward, agctgctggctgaaaaggccgtctatg, reverse, gcgcttctggtggcccttggagtgtg; SDF-1, forward, cgccagagccaacgtcaag and reverse cttgtttaaagctttctccaggtac;actin, forward, tgtttgagaccttcaacacc, reverse, ccagacagcactgtgttggc. CXCR4 and SDF-1 mRNA levels were normalized with actin as a control.

Streptozotocin treatment

Mice 10 weeks of age were injected intraperitoneally with a single high dose of STZ (200 mg/kg). After the STZ injections blood glucose levels and body weights were measured daily, andpancreas samples were collected at 6 h or 2 weeksfor further analysis.

Metabolic parameter measurements

Blood samples were collected from the tail vein using a Microvette CB300 (Sarstedt, Inc., Newton, NC). 15 l aliquots of the samples were used for measurements of glucose concentrations using a glucose analyzer 2300 STAT (YSI Inc., YellowSprings, OH). Insulin concentrations were measured with a Rat Insulin ELISA Kit (Crystal Chem, Inc., Huntsville, AL) and calibrated with mouse insulin standards.

SUPPLEMENTAL FIGURE LEGENDS

Supplemental Figure 1. SDF-1 expression in pancreatic islets of RIP-SDF-1 mice. A. Representative islets from pancreatic sections of 4-week old wild-type (WT) and RIP-SDF-1 transgenic mice were co-immunostained with anti-insulin (green) and anti-SDF-1 (red) antisera. B. Representative islets from pancreatic sections of 4-week old RIP-SDF-1 transgenic mice were co-immunostained with anti-phospho-Akt (red) and anti-SDF-1 (green) antisera. Costaining (yellow) is observed in merged images.

Supplemental Figure 2. Relative SDF-1 and CXCR4 mRNA expression levels in MIN6 cells, INS-1 cells, and mouse pancreatic islets. MIN6 and INS-1 cells express similar levels of CXCR4 mRNA whereas MIN6 cells express SDF-1 mRNA at much higher level than do INS-1 cells. Mouse islets express both CXCR4 and SDF-1. Data shown are mean ±SD relative mRNA expression levels as determined by quantitative RT-PCR and normalized to actin mRNA expression levels.

Supplemental Figure 3. SDF-1 inhibits apoptosis in dispersed mouse islet cells in an AKT-dependent manner. A. Caspase-3 activities of islet cells after 20-24-hour treatment with 10 mM STZ, 10 nM SDF-1, and/or AKT inhibition with 10 nM SH-5, as indicated. B. Caspase-3 activities of islet cells after 20-24-hour treatment with 1 microM thapsigargin, 10 nM SDF-1, and/or AKT inhibition with 10 nM SH-5, as indicated. Data shown are mean ±SD caspase-3 activity (n=3; ** P<0.01, *P<0.05).

1