Occurrence and Prevalence of Antibiotics Resistance in Landfill Leachate

Supporting Information

Occurrence and prevalence of antibiotics resistance in landfill leachate

Yangqing Wang1, Wei Tang1, Jing Qiao1, Liyan Song1,*

1Research Center of Environmental Microbiology and Ecology, Chongqing Institute of Green and Intelligent Technology, Chinese Academy of Science, Chongqing, 401122, China

*Correspondence to Dr. Liyan Song, email:

Includes: 9 Pages, 2 Figures, and 4 Tables

S1 Material and Methods

S1.1 landfills information

The six refuse landfills are Laohukeng landfill of Shenzhen (abbreviated as SZ), Houcun landfill of Taiyuan (TY), Jiangchungou landfill of Xi’an (XA), Jianzigu landfill of Tangshan (TS), Laogang landfill of Shanghai (SH), and Yongchuan landfill of Youngchuan district, Chongqing (YC). Within them, XA and TY landfills are semi-arid climate, TS is humid continental climate and the rest are humid subtropical climate. The refuse landfilling capacity of the six landfills are 8.8 millionm3 (SZ), 12.0 millionm3 (TY), 20.0 millionm3 (XA), 8.0 millionm3 (TS), 80.0 millionm3 (SH), and 3.0 millionm3 (YC), respectively. SZ landfill was put into operation in 2002 and receives 4,000 tons refuse per day. TY landfill was operated in 2008 and receives 5,000 tons refuse per day. XA landfill was operated in 1994 and receives 5,500 tons refuse per day. TS landfill was operated in 2008 and receives 800 tons refuse per day. SH Landfill was put into operation in 1991 and receives 7,600 t of refuse per day. YC landfill was operated in 2007 and receives 100 tons refuse per day.

S1.2 Real-time quantitative PCR

Real-time PCR was conducted on arealplex2 Real time PCR System (eppendorf, Germany) and PCR reactions were carried out in a 25 ul volume containing 1xPower Go taqSYBR Green PCR Master mix (Promega, WI USA), 0.2 uM of each primer, and 1uL of DNA template.Q-PCR amplification protocols were as follows: 15min at 95 oC, followed by 40 cycles of 15 s at 95 oC, 30s at annealing temperature, and 30s extensionsat 72 oC, and then a final melted curve stage with temperature ramping from 60 oC to 95 oC.

Figure S 1. Six landfills in China from which landfill leachate samples were collected. The sampling map was constructed by ArcGIS10.0/ArcMap.The six refuse landfills are Laohukeng landfill of Shenzhen (Shenzhen in map), Houcun landfill of Taiyuan (Taiyuan), Jiangchungou landfill of Xi’an (Xi’an), Jianzigu landfill of Tangshan (Tangshan), Laogang landfill of Shanghai (Shanghai), and Yongchuanlandfill of Youngchuan district, Chongqing (Youngchuan).

Figure S2 Percentage of resistance HPC in total HPC. Abbreviation: SZ: Laohukeng landfill of Shenzhen, TY: Houcun landfill of Taiyuan, XA: Jiangchungou landfill of Xi’an, TS: Jianzigu landfill of Tangshan, SH: Laogang landfill of Shanghai, YC: Yongchuan landfill of Youngchuan district, Chongqing. AMC, chloramphenicol: CHL, ciprofloxacin: CIP, gentamicin: GM, rifampin: RA, sulfisoxazole: SU, tetracycline.

Table S1. Sampling information

Sample / Sampling Site / Climate type / Landfillscapacity( million m3) / Sampling time
SZ-1 / Laohukeng landfill of Shenzhen / humid subtropical climate / 8.8 / Sep. 8th, 2012
SZ-2 / Laohukeng landfill of Shenzhen / humid subtropical climate / 8.8 / Sep. 8th, 2012
SZ-3 / Laohukeng landfill of Shenzhen / humid subtropical climate / 8.8 / Sep. 8th, 2012
SZ-4 / Laohukeng landfill of Shenzhen / humid subtropical climate / 8.8 / Sep. 8th, 2012
SZ-5 / Laohukeng landfill of Shenzhen / humid subtropical climate / 8.8 / Sep. 8th, 2012
SZ-6 / Laohukeng landfill of Shenzhen / humid subtropical climate / 8.8 / Sep. 8th, 2012
TS / Jianzigu landfill of Tangshan / humid continental climate / 8 / Sep. 20th, 2012
SH-1 / Laogang landfill of Shanghai / humid subtropical climate / 80.0 / Sep. 28th, 2012
SH-2 / Laogang landfill of Shanghai / humid subtropical climate / 80.0 / Sep. 28th, 2012
YC / Yongchuan landfill of Chongqing / humid subtropical climate / 3.0 / Nov. 8th, 2012
TY / Houcun landfill of Taiyuan / semi-arid climate / 12.0 / Sep. 12th, 2012
XA / Jiangchungou landfill of Xi’an / semi-arid climate / 20.0 / Sep. 15th, 2012

Table S2. Primers sets and PCR conditions used in this study

Primer
name / Sequence / Annealing Tm / Amplicon size / Targeted gene / Refs
sulI, F / CGCACCGGAAACATCGCTGCAC / 65 / 163 / sulI / [1]
sulI, R / TGAAGTTCCGCCGCAAGGCTCG
sulII, F / TCCGGTGGAGGCCGGTATCTGG / 57.7 / 191 / sulII / [1]
sulII, R / CGGGAATGCCATCTGCCTTGAG
tetO, F / ACGGARAGTTTATTGTATACC / 50.3 / 171 / tet O / [2]
tetO, R / TGGCGTATCTATAATGTTGAC
tetW, F / GAGAGCCTGCTATATGCCAGC / 60 / 168 / tet W / [2]
tetW, R / GGGCGTATCCACAATGTTAAC
blaTEM, F / GCKGCCAACTTACTTCTGACAACG / 61 / 247 / blaTEM / [3]
blaTEM, R / CTTTATCCGCCTCCATCCAGTCTA
Eub338,F / ACTCCTACGGGAGGCAGCAG / 53 / 200 / 16S / [4]
Eub518,R / ATTACCGCGGCTGCTGG

Note: F, forward primer; R, reverse primer; Tm: Temperature.

Reference

1.Pei, R.; Kim, S.-C.; Carlson, K. H.; Pruden, A., Effect of river landscape on the sediment concentrations of antibiotics and corresponding antibiotic resistance genes (ARG). Water Research 2006,40, (12), 2427-2435.

2.Aminov, R.; Garrigues-Jeanjean, N.; Mackie, R., Molecular ecology of tetracycline resistance: development and validation of primers for detection of tetracycline resistance genes encoding ribosomal protection proteins. Applied and environmental microbiology 2001,67, (1), 22-32.

3.Xi, C.; Zhang, Y.; Marrs, C. F.; Ye, W.; Simon, C.; Foxman, B.; Nriagu, J., Prevalence of antibiotic resistance in drinking water treatment and distribution systems. Applied and environmental microbiology 2009,75, (17), 5714-5718.

4.Fierer, N.; Jackson, J. A.; Vilgalys, R.; Jackson, R. B., Assessment of Soil Microbial Community Structure by Use of Taxon-Specific Quantitative PCR Assays. Applied and environmental microbiology 2005,71, (7), 4117-4120.

Table S3.Detection of ARGs in landfill leachate

SZ-1 / SZ-2 / SZ-3 / SZ-4 / SZ-5 / SZ-6 / TS / SH-1 / SH-0 / YC / TY / XA / Frequency indexa
tetO / + / + / + / + / + / + / + / + / + / + / + / + / 12/12
tetW / + / + / + / + / + / + / + / + / + / + / + / + / 12/12
blaTEM / + / + / + / - / + / - / + / + / + / + / - / + / 9/12
sulI / + / + / + / + / + / + / + / + / + / + / + / + / 12/12
sulII / + / + / + / + / + / + / + / + / + / + / + / + / 12/12

a: Frequency was calculated as the number of positive detections in total 12landfill leachate samples

Abbreviation: SZ: Laohukeng landfill of Shenzhen, TY: Houcun landfill of Taiyuan, XA: Jiangchungou landfill of Xi’an, TS: Jianzigu landfill of Tangshan, SH: Laogang landfill of Shanghai, YC: Yongchuan landfill of Youngchuan district, Chongqing.

Table S4.Pearson correlation coefficients and significance levels between ARGs and ARB

16S / totO / totW / blaTEM / sul I / sul II / R2A / AMC / CHL / CIP / GM / RA / SU / TET
16S / 0.02 / 0.00 / 0.55 / 0.01 / 0.02 / 0.27 / 0.48 / 0.47 / 0.46 / 0.72 / 0.57 / 0.79 / 0.31
totO / 0.66 / 0.00 / 0.64 / 0.00 / 0.00 / 0.74 / 0.22 / 0.88 / 0.86 / 0.07 / 0.94 / 0.65 / 0.79
totW / 0.85 / 0.85 / 0.26 / 0.00 / 0.00 / 0.51 / 0.74 / 0.94 / 0.96 / 0.22 / 0.84 / 0.76 / 0.69
blaTEM / 0.19 / 0.15 / 0.36 / 0.34 / 0.74 / 0.51 / 0.41 / 0.19 / 0.78 / 0.50 / 0.77 / 0.66 / 0.68
sul I / 0.69 / 0.82 / 0.92 / 0.30 / 0.00 / 0.35 / 0.65 / 0.85 / 0.58 / 0.15 / 0.78 / 0.39 / 0.69
sul II / 0.68 / 0.83 / 0.79 / 0.11 / 0.83 / 0.48 / 0.48 / 0.78 / 0.63 / 0.18 / 0.98 / 0.32 / 0.76
R2A / (0.34) / (0.11) / (0.21) / (0.21) / (0.30) / (0.22) / 0.08 / 0.00 / 0.01 / 0.04 / 0.05 / 0.00 / 0.00
AMC / (0.22) / 0.39 / 0.11 / (0.26) / 0.15 / 0.22 / 0.52 / 0.01 / 0.04 / 0.03 / 0.09 / 0.34 / 0.10
CHL / (0.23) / 0.05 / (0.02) / (0.41) / (0.06) / (0.09) / 0.75 / 0.73 / 0.00 / 0.08 / 0.13 / 0.01 / 0.01
CIP / (0.24) / 0.06 / (0.02) / 0.09 / (0.18) / (0.15) / 0.75 / 0.59 / 0.75 / 0.43 / 0.10 / 0.04 / 0.02
GM / 0.11 / 0.54 / 0.38 / (0.21) / 0.44 / 0.42 / 0.59 / 0.64 / 0.53 / 0.25 / 0.10 / 0.17 / 0.03
RA / (0.18) / (0.03) / 0.07 / 0.10 / 0.09 / 0.01 / 0.59 / 0.51 / 0.46 / 0.50 / 0.50 / 0.31 / 0.03
SU / (0.09) / (0.15) / (0.10) / (0.14) / (0.27) / (0.32) / 0.83 / 0.30 / 0.69 / 0.60 / 0.43 / 0.32 / 0.00
TET / (0.32) / (0.08) / (0.13) / (0.13) / (0.13) / (0.10) / 0.95 / 0.49 / 0.73 / 0.66 / 0.63 / 0.62 / 0.76

Pearson correlation coefficients are shown in bold font in lower triangular part of the table. Significances of the correlations are shown in normal font in the upper part of the table;Abbreviations:amoxicillin: AMC, chloramphenicol: CHL, ciprofloxacin: CIP, gentamicin: GM, rifampin: RA, sulfisoxazole: SU, tetracycline: TET, 16S: 16S rRNA gene copy number. Negative value was in the brackets.