AtrbohD and AtrbohF negatively regulate lateral root development by changing the localized accumulation of superoxide in primary roots of Arabidopsis

Planta

N. Li · L. Sun · L. Zhang · Y. Song · P. Hu · C. Li · F. S. Hao (*)

State Key Laboratory of Cotton Biology, Henan Key Laboratory of Plant Stress Biology, College of Life Sciences, Henan University, Kaifeng Henan, China

e-mail:

Fig. S1 Expression analysis of AtrbohD and AtrbohF in atrbohD1/F1 and atrbohD2/F2 seedlings.

Total RNA was extracted from 13-day-old Arabidopsis seedlings, and the cDNA was synthesized from the RNA according to the method described by Ma et al. (2012). Gene Actin2 was used as an internal control, and amplified for 23 cycles by PCR. Both AtrbohD and AtrbohF were amplified for 28 cycles by PCR. The gene-specific primers are as follows:

Actin2 forward primer (FP), 5’ – TGTGCCAATCTACGAGGGTT – 3’;

Actin2 reverse primer (RP), 5’ – TGCTCATACGGTCAGCGATA – 3’;

AtrbohD FP, 5’ – GACGGTCCATACGGTGCTC – 3’;

AtrbohD RP, 5’ – TCAGATAATTTTACATAAAAATGAAAAG – 3’;

AtrbohF FP, 5’ – AAgATTCCACCAACCTATACATATACT – 3’;

AtrbohF RP, 5’ – CAATACTCATAAAgCTCATCgTgAT – 3’.

Fig. S2 The early emerged LRs in atrbohD1/F1 and atrbohD2/F2 were near the hypocotyl-root junction.

Five-day-old seedlings grown vertically in solid MS medium were transferred to MS medium for further 7 days. The arrows indicate the early emerged LRs near the hypocotyl-root junction in the double mutants

Fig. S3 Lateral root formation in seedlings.

Five-day-old Arabidopsis seedlings grown vertically in solid MS medium were transferred onto MS medium for another 1 day (a), 2 days (b), 4 days (c), and 8 days (d). The density of LRs and LRP was counted under an AFX-II-A stereomicroscope (Nikon) and a microscope (CX41, Olympus). Eight developmental stages of LRP and LRs (stage I–VII and emergence) were classified according to the standards described by Malamy and Benfey (1997). 1, 2, 3, 4, 5, 6, 7, and 8 in the figure represent stage I, II, III, IV, V, VI, VII, and emergence, respectively

Fig. S4 local accumulation of O2- is important for LR development.

Primary roots from Arabidopsis seedlings vertically grown in solid MS media for 8 days were stained by 3, 5-diaminobenzidine (DAB, a), or by nitroblue tetrazolium (NBT, b). Bar = 50 μm

Fig. S5 Superoxide mainly accumulates in the initiation region of LRP.

a LRP from six-day-old WT plants grown in MS media. b, c LRP from six-day-old atrbohD1/F1 and atrbohD2/F2 WT plants grown in MS media, respectively. d Roots of WT seedlings grown in MS medium with 0.5 µM NAA for four days. Asterisks show the LRP stained with NBT

Fig. S6 Effects of SHAM and NaN3 on generation of O2˙־ in mature root region of seedlings.

Five-day-old WT, atrbohD1/F1 and atrbohD2/F2 seedlings grown on solid MS medium were transferred to MS medium with or without 200 µM SHAM or 1 µM NaN3 for another 3 days. DHE fluorescence intensity in the mature zone of roots were measured. Values are means±SE. Different lowercase letters above the error bar indicate data of the seedlings significantly differ from each other within each treatment by one-way ANOVA and Tukey HSD test (P < 0.05) (n≥20)