Molecular Interactions of the Γ-Clade Homeodomain-Leucine Zipper Class I Transcription

Molecular interactions of the γ-Clade Homeodomain-Leucine Zipper Class I transcription factors during the wheat response to water deficitS

John C. Harris1,2, Pradeep Sornaraj1, Mathew Taylor, Natalia Bazanova, Ute Baumann, Ben Lovell, Peter Langridge, Sergiy Lopato, Maria Hrmova3

From the Australian Centre for Plant Functional Genomics, School of Agriculture, Food and Wine, University of Adelaide, Waite Campus, Glen Osmond, South Australia 5064, Australia

S This article contains SupportingFigures 1-4 and Supporting Tables 1-6.

1 These authors contributed equally to this work and are listed in alphabetical order.

2 Current address: South Australian Research and Development Institute, Waite Campus, Glen Osmond, South Australia 5064, Australia.

3 To whom correspondence should be addressed: Tel.: +61 8 8313 7160; Fax: +61 8 8313 7102; E-mail: .

Supportingmaterials and methods

Protein expression, and purification of TaHDZipI-CELD, TaHDZipI-3(107)-GFP-8xHis and TaHDZipI-biotin fusion proteins

Proteins were expressed in BL21 star E. coli cells (Life Technologies, USA). Cultures were grown at 28ºC for 16 h in a LB broth containing either ampicillin (100 µg/mL) or kanamycin (10 µg/mL) depending on the fusion protein, diluted with a threefold volume of LB and grown for an hour before the addition of 0.5 mM isopropyl-β-d-thiogalactopyranoside. Cultures were grown for a further 6 h at 28 ºC before harvesting by centrifugation (5000xg, 15 min, 4 ºC). Harvested cells were suspended in 1/10 of the culture volume of the cell lysis buffer (50 mMTris pH 8.0; 0.2 mg/mL lysozyme; 1% (v/v) Triton X-100; 10% (v/v) glycerol; 0.5 mM DTT; 2.5U/mL Benzonase; 1 mM PMSF; 3 mMBenzamidine; 1 tablet/ 50 mL Cømplete Ultra protease cocktail inhibitor) and incubated either at room temperature for 1 hour or at 4º C for approximately 16 hours. Intact cells and cell debris were removed by centrifugation (5000xg, 15 min, 4 ºC) and supernatants containing soluble proteins were purified.

Supernatant, containing the TaHDZipI-CELD-6xHis fusion protein, was incubated for approximately 16 hours at 4ºC with the Talon resin (GE Healthcare, Sweden) that had been equilibrated with equilibration buffer (50 mM HEPES-NaOH pH 8.0; 500 mMNaCl, and 10% (v/v) glycerol) in a column. The protein-bound resin was washed with 10 column volumes (CV) of a wash buffer containing 50 mM HEPES-NaOH pH 8.0; 500 mL NaCl, 10% (v/v) glycerol and 30 mM imidazole. The TaHDZipI-CELD fusion protein was eluted with 10 CV of the elution buffer containing 50 mM HEPES-NaOH pH 8.0; 500 mMNaCl, 10% (v/v) glycerol and 250 mM imidazole.

Supernatant containing the TaHDZipI-3(107)-GFP-8xHis fusion protein was incubated for approximately 16 hours at 4ºC with the Talon resin (GE Healthcare, Sweden) that had been equilibrated with equilibration buffer (50 mM HEPES-NaOH pH 8.0; 400 mMNaCl, and 9% (v/v) glycerol) in a column. The protein-bound resin was washed with 10 column volumes (CV) of a wash buffer containing 50 mM HEPES-NaOH pH 8.0; 400 mMNaCl, 9% (v/v) glycerol and 40 mM imidazole. The TaHDZipI-2–CELD fusion protein was eluted with 10 CV of the elution buffer containing 50 mM HEPES-NaOH pH 8.0; 400 mMNaCl, 9% (v/v) glycerol and 500 mM imidazole. The fractions containing fluorescent protein were evaluated under UV light, the presence of chimeric TaHDZipI-3-GFP-8xHis proteins were confirmed by SDS-PAGE and western immuno-blot with anti-His antibody (Clontech, CA, USA).The fractions were pooled and imidazole was removed by dialysis against buffer containing 50 mMTris-HCl pH 8 with 400 mMNaCl and 9% (v/v) glycerol.

For purification of the TaHDZipI-2-biotin fusion protein, the cleared supernatant was mixed with concentrated (threefold) equilibration buffer (500 mM potassium phosphate pH 7.2, 1.5 M NaCl, and 1.2 M ammonium sulphate) and loaded onto a Mutein Streptavidin matrix column (Roche, Germany) that had been equilibrated with the equilibration buffer. The column was washed with 10 CV of the wash buffer containing 100 mM potassium phosphate pH 7.2 and 500 mMNaCl. The TaHDZipI-2-biotin protein was eluted using the elution buffer containing 100 mM potassium phosphate pH 7.2, 500 mMNaCl and 2 mMd-biotin.

Eluted TaHDZipI-CELD and TaHDZipI-biotin proteins were buffer exchanged into 20 mM HEPES-NaOH pH 7.0, 100 mMKCl, 5mM MgCl2 and 10% (v/v) glycerol and concentrated to 0.5-1 mL using an ultra-centrifugation device (10-kDa cut-off) (Amicon, Beverly, USA). SDS-PAGE, followed by protein Coomassie staining and Western-Blot immuno-blots, using anti-HIS (Clontech, Mountain View, USA) or streptavidin conjugate (Sigma, MO, USA) antibodies were performed to confirm protein identities.

Tryptic mapping of TaHDZipI-3 and TaHDZipI-4 fusion proteins by Liquid Chromatography-Electrospray Ionisation tandem Mass Spectrometry (LC-ESI-MS/MS) - The band corresponding to synthesised TaHDZipI-3 and TaHDZipI-4 fusion proteins were excised from the SDS-PAGE gel and placed in sterile Milli-Q water. The protein was digested with trypsin and the peptide mixture was analysed. LC-ESI-MS/MS was performed using an Ultimate 3000 nano-flow system (Dionex) coupled with an Impact II QTOF Mass Spectrometer (Bruker Daltonics Billerica, MA, USA) via an Advance CaptiveSpray source (Bruker Daltonics). 4 µl of each digested sample was loaded onto a trapping column (Acclaim PepMap100, C18, pore size 100 Å, particle size 3 µm, 75 µm ID × 2 cm length, Thermo Scientific) at 3 µl/min using 0.1% (w/v) FA, 5% (v/v) acetonitrile in water. Peptide separation was performed on a Acclaim PepMap RSLC column (C18, pore size 100 Å, particle size 2 µm, 75 µm internal diameter × 15 cm length, Dionex) at 0.3 µl/min using a linear gradient of 5-45% (v/v) acetonitrile in 0.1% (w/v) FA over 90 min. Collision-induced dissociation (CID) spectra were acquired in the 150-2200 m/z range in a data-dependent fashion using Bruker’s Shotgun Instant Expertise™ method. This method uses IDAS (intensity dependent acquisition speed) to adapt the speed of acquisition depending on the intensity of precursor ions (fixed cycle time), and RT2 (RealTime Re-Think) to exclude previously selected precursor ions from undergoing re-fragmentation unless the chromatographic peak intensity of the ion has increased by a factor of 5. Data analysis Post acquisition, acquired spectra were subjected to peak detection and de-convolution using Compass Data Analysis for OTOF (Version 1.7, Bruker Daltonics). Processed MS/MS spectra were then exported to Mascot generic format (mgf) and submitted to Mascot (Version 2.3.02) for identification. Search parameters were as follows; the complete SwissProt database was searched, the enzyme was specified as trypsin with up to 2 missed cleavages, variable modifications of carbamidomethyl of cysteine and oxidation of methionine, MS mass tolerance of 50 ppm, and MS/MS mass tolerance of 0.2 Da.

Cloning of TaHDZipI-3(107) into the pWaldo-GFPd plasmid

A plasmid to express the fusion protein TaHDZipI-3(107)-GFP was generated by incorporating the coding sequence of the DNA binding and LZ region (107 amino acid residues) of TaHDZipI-3 (designated TaHDZipI-3(107)) into the N-terminus of the 8xHis tagged Gremariaen Fluorescent Protein (GFP) in the pWaldo-GFPd plasmid (Waldo et al. 1999). PCR amplification of TaHDZipI-3(107) was performed with forward and reverse primers containing NheI and BamH1 adaptors, respectively. The amplified DNA fragment was ligated in-frame at the N-terminus of GFP.

TEV protease digestion of TaHDZipI-3(107)-GFP-8xHis

Purified TaHDZipI-3(107)-GFP-8xHis was digested with Tobacco-Etch Virus (TEV) protease (Tropea et al. 2009). The final cleavage procedure for downstream use was performed at a molar ratio of 1:1 at 4°C for 4 days in a buffer containing 50 mMTris-HCl pH 8, 1 M NaCl and 10% (v/v) glycerol as salt concentration less than 1 M resulted in the precipitation of the cleaved TaHDZipI-3(107) protein. The cleaved TaHDZipI-3(107) is separated from the histidine tagged GFP and TEV by incubating the mixture with Talon resin and collecting the unbound flow through.

Electrophoretic Mobility Shift Assay (EMSA)

TaHDZipI-3 (107) protein was incubated with biotinylated oligonucleotides at a molar ratio of 2:1 in binding buffer (20 mMHepes-NaOH pH 7.5, 100 mMKCl, 5% (v/v) glycerol, 1 mM DTT and 1 mM EDTA) at 25˚C for 20 min. The complexes formed were resolved using 6% (v/v) non-denaturing polyacrylamide gels in Tris-Boric acid-EDTA buffer (TBE; 44.5 mMTris base, 44.5 mMboric acid, 0.5 mM EDTA) at 100 V and 4˚C. The protein-DNA complexes were transferred to Biodyne B membrane (Life Sciences, Australia) in TBE buffer at 380 mA for 1 hour. The membrane was soaked in blocking solution (100 mMTris-HCl pH 7.5, 100 mMNaCl, 2 mM MgCl2 and 3% (w/v) BSA) at 30˚C for 1 hour. To visualise DNA-protein complexes, streptavidin alkaline phosphatase conjugate (Sigma, USA) diluted (1:10,000) in AP-A buffer (100 mMTris-HCl pH 7.5, 100 mMNaCl, 2 mM MgCl2) was added and the membrane was gently shaken at ambient temperature for 10 min. Membrane was washed twice in AP-A buffer and once in AP-B buffer (100 mMTris-HCl pH 9.5, 100 mMNaCl, 50 mM MgCl2) for 10 min each. Membrane was developed with BCIP/NBT-purple liquid reagent (Sigma, MO, USA) and images were scanned.

DNA-Protein interaction assay using Enzyme-Linked Immunosorbant Assay (DPI-ELISA)

DPI-ELISA was performed as described (Brand et al. 2010) with the following modifications. Biotinylated oligonucleotides of known concentrations were incubated in streptavidin-coated 96-well plates (Thermo Fisher Scientific, Australia) at ambient temperature for one hour. The wells were washed twice with TBS-T buffer (20 mMTris-HCl pH 7.5, 180 mMNaCl, 0.1% (v/v) Tween20) to remove unbound oligonucleotides. Unbound streptavidin resins were blocked with TBS-T buffer containing 20% non-fat biotin free dry milk (Santa Cruz, USA) for two hours at ambient temperature. TaHDZipI-3(107)-GFP fusion protein was incubated with the streptavidin bound biotinylated oligonucleotides at ambient room temperature for one hour with shaking. The protein-DNA complex was washed thrice with PBS-T (10 mM Na2HPO4/NaH2PO4, pH 7.5, 140 mMNaCl, 0.1% (v/v) Tween 20) to remove unbound proteins. Antibody specific to GFP (Proteintech, USA) conjugated with horseradish peroxidase (HRP) was used to confirm protein-DNA interactions. The HRP activity of the antibody bound to the protein-DNA complex was assayed by incubating the complex with tetramethyl-benzidin (Sigma, USA) for up to 30 minutes. The reaction was stopped by an equal volume of 1 N HCl and absorbance was measured at 450 nm.

Supporting references

Amalraj A, Luang S, Kumar MY, Sornaraj P, Eini O, Kovalchuk N, Bazanova N, LiY, Yang N, Eliby S, Langridge P, Hrmova M, Lopato S (2015) Change of function of the wheat stress-responsive transcriptional repressor TaRAP2.1L by repressor motif modification. Plant Biotechnol, in the press, doi: 10.1111/pbi.12432

Brand LH, Kirchler T, Hummel S, Chaban C, Wanke D (2010) DPI-ELISA: a fast and versatile method to specify the binding of plant transcription factors to DNA in vitro. Plant Methods 6:25-36

Lopato S, Bazanova N, Morran S, Milligan AS, Shirley N, Langridge P (2006) Isolation of plant transcription factors using a modified yeast one-hybrid system. Plant Methods 2: 3-17

Tropea J, Cherry S, Waugh D (2009) Expression and purification of soluble His6-tagged TEV protease. In:high throughput protein expression and purification (Doyle S, ed), Humana Press, pp:297-307

Waldo GS, Standish BM, Berendzen J, Terwilliger TC (1999) Rapid protein-folding assay using green fluorescent protein. Nat Biotechnol17:691-695

Legendsto supportingfigures

SupportingFig.1 Analyses of protein-protein (Y2H) and protein-DNA (Y1H) interactions determined in yeast.

(a), Confirmation of the yeast GAL4 binding domain (BD) fused TaHDZipI-3 (bait in the Y2H screen) interaction with full length TaHDZipI-4 and TaHDZipI-5 [prey proteins fused to the GAL4 activation domain (AD)] in the Y2H assay. Empty bait pGBKT7 and prey pGADT7 vectors were used as negative controls. (b), Analyses of TaHDZipI-3, TaHDZipI-4, TaHDZipI-5 (γ-clade HD-Zip I TF) interactions with HDZ I-II elements (CAATNATTG repeated 4-fold, each repeat with a different nucleotide in N position) in the Y1H assay. TaHDZipI-1 and TaHDZipI-2 were previously demonstrated to interact strongly with these elements (Lopato et al. 2006), and therefore used as positive controls. Interactions of HD-Zip I TFs with the HDZ IV element (CATTAAATG repeated 4-fold) that is specific for HD-Zip class IV proteins were used as negative controls.

SupportingFig.2Schematic representation of the cyclic drought conditions used in the experiment. Re-watering occurred, when plants showed wilting as an indication of drought stress. Flag leaf material was harvested at the times indicated in days. Error bars represent standard deviation of biological triplicates.

SupportingFig.3 SDS-PAGE profilesof the fusion TaHDZipI-CELD (A), TaHDZipI-biotin (B) and TaHDZipI-3(107)-GFP (C) proteins.

(a), St. indicates Protein Precision PlusProteinTM Dual Color Standards (Bio-Rad, CA, USA), lane 1, TaHDZipI-3-CELD (77 kDa); lane 2, TaHDZipI-4-CELD (74 kDa); lane 3, TaHDZipI-5-CELD (79 kDa). (b),St. indicates Protein Precision PlusProteinTM Dual Color Standards, lane 1, TaHDZipI-3-biotin (37 kDa); lane 2, TaHDZipI-4-biotin (34 kDa); lane 3, TaHDZipI-5-biotin (39 kDa). (c), St. indicates Protein Precision PlusProteinTM Dual Color Standards, lane 1, TaHDZipI-3(107)-GFP (44 kDa); lane 2, TaHDZipI-3(107)-GFP cleaved with TEV protease; lane 3, TaHDZipI-3(107) (10 kDa). SDS-PAGE gels were stained by Coomassie Brilliant Blue. Grey boxes indicate near homogenous proteins used for protein interaction assays.

SupportingFig. 4Binding of TaHDZipI-3(107) to HDZ1, HDZ2, HDZmutant and the GCC boxcis-elementsdetected by EMSA (A) and DPI-ELISA (B).

(a),An EMSA analysis (Amalraj et al. 2015) of TaHDZipI-3(107) with the biotinylated HDZ1, HDZ2, HDZmutant and the GCC box cis-elements containing triple repeating motifs. Biotinylated cis-elements are indicated by arrows. Lower bands correspond to free unbound cis-elements and top bands are cis-elements bound to TaHDZipI-3(107). Protein and cis-element only samples were used as negative controls as indicated.(b), DPI-ELISA analyses (Waldo et al. 1999) of interactions between TaHDZipI-3(107) protein and HDZ1 3x(5’-CAATCATTG-3’/3’-CAATGATTG)-5’), HDZ2 3x(5’-CAATAATTG-3’/3’-CAATTATTG-5’), HDZmutant3x(5’-CAGTTACTG-3’/3’-GAGTAACTG -5’) and the GCC box 3x(5’-AGCCGCC-3’/3’-GGCGGCT-5’) cis-elements. Proteins without biotinylated cis-element served as negative controls. Negative control values are subtracted from experimental values. Absorbance values are means of triplicate assays with standard deviations.

Supporting Table 1.Genomic structure of HD-Zip I γ-clade transcription factor genes. Table reports the nucleotide (nt) position and size of introns and exons within the coding sequences of HD-Zip I γ-clade genes.

Species / Identifier / Exon 1 (nt) / Intron 1 (nt) / Exon 2 (nt)
Arabidopsis thaliana / Athb7 / 1-360 (360) / 361-580 (220) / 581-997 (417)
A. thaliana / Athb12 / 1-354 (354) / 355-540 (186) / 541-894 (354)
Brachypodiumdistachyon / Bradi4g35910 / 1-354 (354) / 355-460 (106) / 461-838 (378)
B. distachyon / Bradi3g50220 / 1-363 (363) / 364-436
(73) / 437-751 (315)
B. distachyon / Bradi5g17170 / 1-423 (423) / 424-530 (107) / 531-836 (306)
Medicagotruncatula / MtHB1 / 1-366 (366) / 367-628 (262) / 629-988 (360)
Nicotianabenthamiana / Niben.v0.4.2.Scf17952:61301-63100 / 1-393 (393) / 394-476
(83) / 477-851 (375)
Oryzasativa / Oshox6 / 1-354 (354) / 355-448
(94) / 449-844 (396)
O. sativa / Oshox22 / 1-486 (486) / 4887-603 (117) / 604-948 (345)
O. sativa / Oshox24 / 1-461 (461) / 462-548
(87) / 549-873 (325)
Poplar trichocarpa / PtrHox2 / 1-312 (312) / 313-428 (116) / 429-707 (279)
P. trichocarpa / PtrHox14 / 1-357 (357) / 358-452
(95) / 453-812 (360)
P. trichocarpa / PtrHox52 / 1-357 (357) / 358-473 (116) / 474-833 (360)
Sorghum bicolour / Chr2:65694528..65695430 / 1-363 (363) / 364-534 (171) / 535-903 (369)
S. bicolour / Chr4:63271127..63272004 / 1-423 (423) / 424-548 (125) / 549-878 (330)
S. bicolour / Chr6:53127574..53128487 / 1-462 (462) / 463-563 (101) / 564-914 (351)
Solanum lycopersicum / Solyc01g096320 / 1-393 (393) / 394-483
(90) / 484-810 (327)
Solanum tuberosum / PGSC0003DMC400000519 / 1-390 (390) / 391-471
(81) / 472-840 (369)
S. tuberosum / PGSC0003DMC400032249 / 1-333 (333) / 334-430
(97) / 431-742 (312)
Triticum durum / TdHDZipI-3 / 1-336 (336) / 337-456 (120) / 457-870 (414)
T. durum / TdHDZipI-4a / 1-392 (392) / 393-492 (100) / 493-781 (289)
T. durum / TdHDZipI-4b / 1-386 (386) / 387-494 (108) / 495-774 (280)
T. durum / TdHDZipI-5a / 1-453 (453) / 454-558 (105) / 559-885 (327)
T. durum / TdHDZipI-5b / 1-450 (450) / 451-545
(95) / 546-884 (339)
Zea mays / GRMZM2G351330 / 1-435 (435) / 436-563 (128) / 564-932 (369)
Z. mays / GRMZM2G117164 / 1-411 (411) / 412-500
(89) / 501-797 (297)
Z. mays / GRMZM2G041462 / 1-357 (357) / 358-529 (172) / 530-892 (363)
Z. mays / GRMZM2G034113 / 1-351 (351) / 352-592 (241) / 593-976 (384)

Supporting Table 2.Summary of the relative differences seen in three South Australian wheat cultivars in response to water deficit.The data summarise the work of Izanlooet al. (2008).

Phenotype / Relative phenotypic response
Water use, WW / Excalibur / = / Kukri / RAC875
Water use during recovery / Excalibur / Kukri / = / RAC875
% stomatal conductance recovery, 24hr / Excalibur / Kukri / RAC875
% stomatal conductance recovery, 48hr / RAC875 / Excalibur / Kukri
Leaf temperature, recovery / Excalibur / RAC875 / = / Kukri
Days to anthesis, MWS / Excalibur / Kukri / = / RAC875
Days to anthesis, SWS / Excalibur / Kukri / = / RAC875
Plant height, WW / Kukri / RAC875 / = / Excalibur
Plant height, SWS / Excalibur / = / Kukri / = / RAC875
Peduncle % reduction, SWS / Kukri / RAC875 / Excalibur
Grain yield, WW / Excalibur / = / Kukri / = / RAC875
Grain yield reduction, SWS / Kukri / Excalibur / RAC875
Grain yield reduction, MWS / Excalibur / Kukri / RAC875
Grain per spike, MWS / Excalibur / = / Kukri / = / RAC875
Grain per spike, SWS / Kukri / Excalibur / = / RAC875
Grain size, WW / Excalibur / = / Kukri / RAC875
Grain size, SWS / Kukri / Excalibur / RAC875
Harvest index, WW / Excalibur / = / Kukri / = / RAC875
Harvest index, SWS / Kukri / Excalibur / RAC875
Harvest index, MWS / Excalibur / Kukri / = / RAC875
Root mass, WW / Excalibur / = / Kukri / = / RAC875
Root mass, SWS / Excalibur / Kukri / = / RAC875
Osmotic adjustment, SWS / Excalibur / RAC875 / Kukri
% decrease chlorophyll content after anthesis, SWS / Kukri / Excalibur / = / RAC875
Stem water soluble carbohydrate, WW / Excalibur / Kukri / RAC875
% increase stem water soluble carbohydrate, SWS / Excalibur
(no incr.) / Kukri / RAC875
ABA content, WW / Excalibur / = / Kukri / = / RAC875
Increase in ABA content, SWS / Excalibur / Kukri / = / RAC875

Abbreviations used: WW, well-watered control conditions; SWS, severe water stress conditions; MWS, mild water stress conditions. The qualitative symbols represent relative responses when compared between the three cultivars: =, similar levels of response between;, greater response than;, much greater response than;, weaker response than;, much weaker response than.

Supporting Table 3. Amino acid sequences of tryptic fragments of TaHDZipI-3(107)-GFP, TaHDZipI-3-CELD and TaHDZipI-4-biotin identified by Electrospray Ionisation tandem Mass Spectrometry.

Match / Tryptic peptide sequences1
TaHDZipI-3(107) / ELGLQPR
QVAIWFQNKR
RFSEEQIKSLESMFATQTK
FSEEQIKSLESMFATQTKLEPR
TaHDZipI-3-CELD / LAEMLREPGGAK
ELGLQPR
FSEEQIK
QALLNQLEK
QVAIWFQNK
SLESMFATQTK
DKQALLNQLEK
LYSASEGCGGSGK
LAVAGMSMKDEFVDAGGASK
TaHDZipI-4-biotin / QDQSASCDAAAEVDDK
SKQLEQDFAELR
LTLAAQLEELKK
SNNVSSCIVAK
SLESTFHTR
VELLKQEK
FTEEQVR

1Amino acid sequences are indicated in a 1-letter code.

Supporting Table4.Discrete Optimised Protein Energy (DOPE)/Modeller Objective Function (MOF), Ramachandran statistics (allowed residues), G-factor and z-score (derived from ProSa2003) parameters of structural models of TaHDZipI-3 in complex with HDZ1, HDZ2 and HDZmutantcis-elements.

Model/cis-element complexDOPE/MOF Allowed residues G-factor z-score

(%)

TaHDZipI-3/HDZ1 -10,477/928 100.0 0.0 -4.50
TaHDZipI-3/HDZ2 -10,693/763 100.0 0.0 -4.57
TaHDZipI-3/HDZmutant-10,263/724 100.0 0.1 -4.53

Supporting Table5.Residues of TaHDZipI-3 (chains A and B), forming hydrogen bonding interactions between amino acid residues and HDZ1, HDZ2 and HDZmutantcis-elements.

Model / Residues / Number of hydrogen bonding interactions and distancesin Å / Number
DNA bases / DNA
phospho-diester backbone
Thymine / Cytosine / Adenine / Guanine
TaHDZipI-3:A/HDZ1 / Arg26 / 2 (3.3; 3.4) / - / - / - / - / 2
Arg29 / - / - / - / - / 2 (2.9; 3.1) / 2
Arg65 / - / - / - / - / 1 (3.5) / 1
Asn73 / 1 (3.0) / - / - / - / - / 1
Lys81 / - / - / - / - / 1 (3.4) / 1
TaHDZipI-3:B/HDZ1 / Arg26 / 2 (3.3; 3.5) / - / - / - / 1 (3.0) / 3
Lys28 / - / - / - / - / 2 (2.8; 3.2) / 2
Gln72 / 1 (3.2) / - / - / - / - / 1
Asn73 / 1 (3.5) / - / - / - / - / 1
Total / 7 / 0 / 0 / 0 / 7 / 14
TaHDZipI-3:A/HDZ2 / Arg26 / 3 (3.2; 3.3; 3.4) / - / - / - / 3
Arg29 / - / - / - / - / 3 (2.8; 3.1; 3.3) / 3
Asn73 / 1 (3.4) / - / - / - / - / 1
TaHDZipI-3:B/HDZ2 / Arg26 / 1 (3.2) / - / - / - / - / 1
Lys28 / 1 (2.8) / - / - / - / - / 1
Lys47 / - / - / - / - / 2 (3.2; 3.3) / 2
Arg65 / - / - / - / - / 1 (3.4) / 1
Gln72 / 1 (3.4) / - / - / - / - / 1
Asn73 / 2 (3.0; 3.1) / - / - / - / - / 2
Total / 9 / 0 / 0 / 0 / 6 / 15
TaHDZipI-3:A/
HDZmutant / Arg26 / - / 2 (3.1; 3.2) / - / - / - / 2
Trp70 / 1 (3.2) / - / - / - / - / 1
Asn73 / 1 (2.7) / - / - / - / - / 1
TaHDZipI-3:B/
HDZmutant / Arg26 / 1 (3.3) / - / - / 2 (2.8, 3.2) / - / 3
Lys28 / - / - / - / - / 1 (2.8) / 1
Lys47 / - / - / - / - / 1 (3.1) / 1
Arg65 / - / - / - / - / 1 (3.4) / 1
Gln72 / 1 (3.2) / - / - / - / - / 1
Asn73 / - / - / - / 1 (3.1) / - / 1
Total / 4 / 2 / 0 / 3 / 3 / 12

1 The separations equal or less than 3.5 Å are indicated in brackets.

Supporting Table6. Primers used for Q-PCR.

Gene / Forward primer sequence / Reverse primer sequence / Product size
TaHDZipI-3 / TCGTCGTTCCCGTTCCACTC / GGGAATTCCTTTATGGTGCTTGAC / 126
TaHDZipI-4 / CGTCAGGTAGAATCGTAGAACAG / TCACGGACATGAATCCCAGAG / 134
TaHDZipI-5 / CGGCTTGTGTGTGTAGCTTCAC / GGACCCACCCGTCATTGC / 107
TaWZY2 / AGCAGCTACTCGAGAGTTGAG / ATCCCGGGTACATCCAAGCAG / 161
TaCOR410 / GGACCTCGATTGAATTGTTGG / ATCCAGGACCTTCAAAGACTG / 149

1