Methylomic analysis of conversion to psychosis
SUPPLEMENTARY INFORMATION
UHR: Vulnerability / UHR: BLIPS / UHR: Attenuated psychosis / PsychosisFamily history of psychosis OR an individual with schizotypal
personality disorder
AND a decline in functioning OR
sustained low functioning / Transient psychotic symptoms:
symptoms in the subscales
of unusual thought content,
nonbizarre ideas, perceptual
abnormalities, disorganized
speech; duration of the episode < 1 week; spontaneous remission;
symptoms occurred within the
past 12 months
AND decline in functioning OR sustained low
functioning / Subthreshold attenuated positive
symptoms: eg, ideas of reference,
“magical” thinking, perceptual
disturbance, paranoid ideation, odd
thinking and speech; held
with either subthreshold frequency
or subthreshold intensity; present
for 1 week in the past 12 months
AND decline in functioning OR sustained
low functioning / Suprathreshold psychotic symptoms on disorders of thought content subscale, perceptual abnormalities subscale and/or
disorganized speech subscale
Score on the frequency scale of more than 3 to 6 times per week, over an hour each time
Psychotic symptoms present for longer than 1week
Table S1: main criteria for UHR and psychosis (From Fusar Poli et al, 2012 (3))
Table S2. Summary information about data clean-up procedure
sitesTotal number of methylation sites / 485 577
Total number of samples / 78
Samples having 1% of sites with a detection p-value greater than 0.05 removed / 0
Sites with beadcount <3 in 5% of samples removed / 438 / -4,750a
Sites having 1% of samples with a detection p-value greater than 0.05 removed / 4455
Non-specific sites removed* / 41 937 / -57,631b
Sites with SNPs within the CpG probes removed * / 20 869
Probes on X and Y chromosomes removed / 11 184 / -11,184
SNP probes / 65 / -65
total number of sites / 411 947
total number of samples / 78
* from Price et al (11)
a 4,750 unique probes were removed (143 present in both categories)
b 57,631 unique probes were removed (1,279 were also in the sites having 1% of samples with a detection p-value greater than 0.05 removed and 1,362 were on X or Y chromosomes (60,272 unique probes -1362 -1279= 57,631)
Figure S1: Samples quality control
Figure S2: Density plot given by Minfi package (Group_A: non converters – Group_B: converters)
Figure S3. QQplot of the test of difference between converters and non-converters in methylation change between baseline and final measure. The shaded band represents 95% CI values.
Figure S4: positive control of bisulfite conversion using the MAEL gene by PCR followed by gel electrophoresis (agarose 2%)
MWM: DNA ladder – 01: sample n°1 – 02: sample n°2 – H20: water- negative control
NB: sample without bisulfite treatment – BS: sample treated with bisulfite
Figure S5: non methylation specific PCR of GSTM5 (first part of the promoter) after bisulfite treatment. DNA amplification is only with bisulfite samples; primers are seen in sample without bisulfite treatment
Table S3: technical conditions of PCR
Gene / Primers / Annealing temperatureCHL1
ch3: 240139 / Forward: GATGGTAATTGGTGGGTTTT / 56°C
Reverse: CAATAACTTTTAAATACTTATTATACATCA-biotin
Sequencing: GATGGTAATTGGTGGGTTTT
GSTM5
first part of the promoter / Forward: AGGGTTGGATGGATTTATGG / 60°C
Reverse: AACTAAAATCAATAAACCCCCTCC-biotin
Sequencing: TGGATGGATTTATGGAG
GSTM5
second part of the promoter / Forward: GGAGGGGGTTTATTGATTTTAGT / 59°C
Reverse: AACTCAAACTTTAAAAAACCCAAAAA-biotin
Sequencing: GTGTTTAGGGGTTGTG
Figure S6: examples of results from pyrosequencing
CHL1: red circle correspond to CpG of interest
GSTM5 – first part of the promoter
GSTM5 – second part of the promoter
Figure S7. Manhattan plot of CpG set analysis for the test of difference between converters and non-converters in methylation change between baseline and final measure with adjustment for sex
1
Supplemental material
Methylomic analysis of conversion to psychosis
Table S4: whole results of the exploratory analysis
chromosome / start / end / β value / Number of CpG / p value / fwerDMR concordant at M0 and MF
chr1 / 146549909 / 146550467 / 0,19 / 4 / 0,00025 / 0,328
chr5 / 1594282 / 1594733 / 0,13 / 7 / 0,00242 / 0,527
chr1 / 110254662 / 110254835 / 0,14 / 6 / 0,00267 / 0,495
chr3 / 195489306 / 195489782 / 0,14 / 3 / 0,01235 / 0,868
chr5 / 1856713 / 1857477 / 0,12 / 4 / 0,01758 / 0,902
chr5 / 176797999 / 176798049 / -0,14 / 2 / 0,02124 / 0,964
chr11 / 325915 / 325964 / 0,14 / 2 / 0,02182 / 0,966
chr19 / 17599784 / 17600122 / 0,14 / 2 / 0,02281 / 0,971
chr2 / 121496875 / 121497334 / -0,14 / 2 / 0,02626 / 0,981
chr17 / 724273 / 724374 / 0,13 / 2 / 0,03601 / 0,992
chr15 / 101093834 / 101093900 / 0,13 / 2 / 0,05042 / 0,995
chr19 / 13875014 / 13875111 / -0,13 / 2 / 0,05453 / 0,997
chr8 / 143751796 / 143751801 / -0,12 / 2 / 0,07365 / 0,998
chr9 / 128776861 / 128777132 / -0,12 / 2 / 0,08280 / 0,998
chr1 / 110254919 / 110255096 / 0,12 / 2 / 0,10083 / 0,998
DMR at M0 not at MF
chr19 / 12876846 / 12877000 / -0,11 / 3 / 0,07436 / 0,993
chr22 / 50981121 / 50981406 / 0,12 / 2 / 0,10054 / 0,998
chr1 / 114429965 / 114430031 / 0,11 / 2 / 0,13025 / 1
chr20 / 20036684 / 20036779 / 0,11 / 2 / 0,14181 / 1
chr20 / 52492209 / 52492248 / 0,11 / 2 / 0,15055 / 1
chr17 / 4081325 / 4081428 / 0,10 / 2 / 0,16762 / 1
DMR at MF not at M0
chr22 / 24348549 / 24348715 / -0,12 / 3 / 0,05973 / 0,982
chr19 / 55013946 / 55013954 / -0,12 / 2 / 0,11081 / 1
chr22 / 24384400 / 24384525 / 0,10 / 2 / 0,18442 / 1
1
Supplemental material
Methylomic analysis of conversion to psychosis
Table S5. Top 100 findings obtained for the test of difference between converters and non-converters in methylation change between baseline and final measure with adjustment for sex
Table S5 (continued)
1
Supplemental material
Methylomic analysis of conversion to psychosis
Figure S8: methylation difference in 10 CpGs of GSTM5 gene promoter at initial (M0) and final time (MF)
1
Supplemental material