Supplemental Research Data

Supplemental Methods

Materials and plasmids. Tunicamycin (Tm), wortmannin, 3-methyladenine, Bafilomycin A1 and MG-132 were purchased from Calbiochem EMB Bioscience Inc. Cell media, EBSS media and antibiotics were obtained from Life Technologies (Maryland, USA). Puromycin, pepstatin and E64D were purchased from Sigma. Fetal calf serum was obtained from Atlanta Biologicals. Hoechst, lysotraker, and Acridine orange were purchased from Molecular Probes. All transfections were performed using the Effectene reagent (Quiagen). DNA was purified with Qiagen kits.

SOD1-EGFP expression vectors were described before (Hetz et al., 2007). Primers were designed to introduce a SalI site to allow subcloning SOD1 mutants into pEGFP-N1 (Clontech, Palo Alto, CA) and to remove the SOD1 translation stop codon. Mutants were generated via site directed mutagenesis of the SOD1WT template using the Quick Change kit (Stratagene, La Jolla, CA). For the LC3-EGFP expression vectors the rat LC3 cDNA was cloned into the BglII and EcoRI sites of the pEGFP-C1 vector (Clontech laboratories) as described previously (Kabeya et al., 2000). The XBP-1s expression vector was previously described (Lee et al., 2003), where the cDNA was obtained from NIH3T3 cells treated with tunicamycin and the XBP-1s cDNA cloned into the pCDNA.3 vector between the HindIII and ApaI sites.

XBP-1 mRNA splicing assays. Two assays were employed to analyze XBP-1 mRNA splicing (Lisbona et al., 2009). In brief, for cell lines, PCR primers 5'- ACACGCTTGGGAATGGACAC-3' and 5'- CCATGGGAAGATGTTCTGGG-3' encompassing the spliced sequences in xbp-1 mRNA were used for the PCR amplification with AmpliTaq Gold polymerase (Applied Biosystem, Foster City, CA). We separated the PCR products by electrophoresis on a 2.5% agarose gel (Agarose-1000 Invitrogen, Carlsbad, CA) and visualized them by ethidium bromide staining. In tissue, a more sensitive assay was used in spinal cord extracts to monitor XBP-1 mRNA splicing. PCR using the sense primer mXBP1.3S (5'-AAACAGAGTAGCAGCGCAGACTGC-3') and antisense primer mXBP1.2AS (5'-GGATCTCTAAAACTAGAGGCTTGGTG-3') amplified a 600-bp cDNA product encompassing the IRE1 cleavage sites. The fragment was further digested by PstI to reveal a restriction site that is lost after IRE1-mediated cleavage and splicing of the mRNA.

Knockdown of UPR and autophagy components in motoneurons. We generated stable motoneuron cell lines with reduced levels of XBP-1, IRE1a, Beclin-1 and EDEM using methods previously described (Hetz et al., 2007) by targeting the respective mRNA with shRNA using the lentiviral expression vector pLKO.1 and puromycin selection. As control empty vector or a shRNA against the luciferase gene were employed. Constructs were generated by The Broad Institute (Boston, USA) based on different criteria for shRNA design (see http://www.broad.mit.edu/genome_bio/trc/rnai.html). We screened a total of five different constructs for each gene and selected the most efficient one for further studies. Targeting sequences identified for the mouse XBP-1, IRE1a, Beclin-1, EDEM1 (two constructs) mRNA are 5'-CCATTAATGAACTCATTCGTT-3', 5'-GCTCGTGAATTGATAGAGAAA-3', 5'-GCGGGAGTATAGTGAGTTTAA-3' , 5'-CCATATCATATCTGTGGACAA-3' and 5'-GCCCTTAAAGAGCATCTACAT-3', respectively. For ATG5 mRNA knock-down we employed a combination of five different targeting sequences including 5'-GCCAAGTATCTGTCTATGATA-3', 5'-CCTTGGAACATCACAGTACAT-3', 5'-GCAGAACCATACTATTTGCTT-3', 5'-GCATCTGAGCTACCCAGATAA-3'and 5'-CCCTGAAATGGCATTATCCAA-3'.

The NSC34 cell model was selected for this study because it has several valuable characteristics of motor neurons (Cashman et al., 1992), which include the ability to induce contraction in co-cultured muscle cells; the expression of neurofilaments; the generation of action potentials and the synthesis, storage and release of acetylcholine (Cashman et al., 1992). In addition, NSC34 cells induce acetylcholine receptor clusters on co-cultured myotubules (Cashman et al., 1992), and they are sensitive to mutant SOD1 neurotoxicity (Hetz et al., 2007). Cells were grown in the presence of 3 mg/ml puromycin to maintain selective pressure.

Assays for mutant SOD1 aggregation and detection of intracellular inclusions. We developed assays using the transient expression of human SOD1WT and the mutants SOD1G93A and SOD1G85R as EGFP fusion proteins. These constructs were employed to visualize and quantify the formation of intracellular SOD1 inclusions in living cells by fluorescent confocal microscopy. SOD1 oligomers were visualized in total cell extracts prepared in RIPA buffer and sonication, and then analyzed by Western blot. Alternatively, nuclear cell lysates were prepared in 1% NP-40 in PBS containing protease inhibitors. After solubilization on ice for 30 min, cell nuclei were precipitated by centrifugation at 3000 rpm for 5 min and cell extracts were centrifuged at 10,000 g for 10 min to collect NP-40 soluble and insoluble material. Pellets were resuspended in Western blot sampler buffer containing SDS.

Quantification of autophagy and cell viability. Different assays and control experiments were employed to monitor autophagy-related processes following the recommendations and precautions described in (Klionsky et al., 2008). Lysosomes or acidic compartments were visualized after staining with different dyes. Living cells were stained with 200 nM lysotraker or 600 nM Acridine orange for 45 min at 37°C and 5% CO2. Cells were washed three times with cold PBS and then fixed for 30 min with 4% formaldehyde on ice, then maintained in PBS containing 0.4% formaldehyde for immediate visualization on a confocal microscope. Alternatively, cells were loaded with DQ-BSA to monitor lysosomal activity as previously described (Klionsky et al., 2008). After calibrating the concentration and timing of pre-incubation we found that 20 mg/ml of DQ-BSA for 16h was the optimal condition for high quality staining.

Autophagy was monitored by analyzing LC3-positive dots or the levels of LC3-II by Western blot and its flux through the autophagosomal/lysosomal pathway as described (Klionsky et al., 2008). Autophagosomes were visualized after the expression of LC3-EGFP after the transient transfection of the lowest amounts of DNA titered to obtain the best signal to noise ratio (1/3 amount of recommended concentrations by transfection kit). All quantifications were performed for a total of at least 150 cells in duplicate for each independent experiment. As control, the background levels of puncta were examined by fluorescence from untagged GFP, where no dots were observed. In control experiments, cells were treated with 10 mM 3-MA to inhibit autophagy.

LC3 is initially synthesized in an unprocessed form, proLC3, which is converted into a proteolytically processed form lacking amino acids from the C terminus, LC3-I, and is finally modified into the PE-conjugated form. To monitor LC3-II dynamics protein samples were processed in cold RIPA and immediately analyzed by Western blot using 15% SDS-polyacrilamide gels. As internal control LC3-II levels were compared with Hsp90 levels. To follow the flow of LC3I/II through the autophagy pathway, cells were treated with a mix of 200 nM bafilomycin A1, 10 mg/ml pepstatin and 10 mg/ml E64d. In addition, the assays were established in standard assays of autophagy using cells grown in serum free RPMI (not shown). Alternatively, to monitor flux we transiently expressed a tandem monomeric RFP-GFP-tagged LC3 (Klionsky et al., 2008). The GFP signal of this fusion protein is sensitive to the acidic and/or proteolytic conditions of the lysosome lumen, whereas mRFP is more stable. Therefore, co-localization of both GFP and RFP fluorescence indicates a compartment that has not fused with a lysosome. In contrast, an mRFP signal without GFP corresponds to an autophagolysosome. Thus, the LC3 flux then can be followed in living cells in the absence of drug treatment. As control to trigger autophagy in vivo, mice were starved for 24h and then liver extracts were prepared for western blot analysis to monitor LC3 levels as previously described (Mizushima et al., 2004).

Cell viability was monitored using the MTT assay or propidium iodide staining (Lisbona et al., 2009). Alternatively, cell cultures were stained with 1 mg/ml of PI and visualized with a fluorescent microscope. Proteasomal activity was monitored using the fluorescent substrate GFPu by FACS analysis. ERAD was monitored after expressing CD3-d-YFP alone, because it is a well-established ERAD substrate when expressed in the absence of the other receptor subunits.

Animal experimentation. XBP-1flox/flox mice were crossed with mice expressing Cre recombinase under the control of the Nestin promoter to achieve deletion of XBP-1 in the nervous system (XBP-1Nes-/-) (Hetz et al., 2008). We employed as an ALS model the SOD1G86R transgenic strain (the equivalent of human SOD1G85R) which were generated in the FVB/N strain (strain FVB-Tg(Sod1-G86R)M1Jwg/J, The Jackson Laboratory). The expression of the SOD1 mutant gene is driven by the endogenous SOD1 promoter. As shown in Supplemental Fig. S3A, the overexpression levels of mutant SOD1 are very low compared with other transgenic mice such as the SOD1G93A line, decreasing the possible non-specific effects of overexpression. In addition, SOD1G86R encodes an enzyme with low SOD activity, and thus expression of the altered enzyme does not significantly affect overall SOD1 cellular activity when added to the genome in the presence of two wild-type parental genes. All animal experiments were performed according to procedures approved by the Institutional Review Board’s Animal Care and Use Committee of Harvard School of Public Health (approved animal protocol 04137) and the Faculty of Medicine of the University of Chile (approved protocol CBA # 0208 FMUCH). The forth to sixth generations of XBP-1Nes-/-/SOD1G86R mice were used to expand the colony and obtain experimental groups.

Disease onset analysis. Disease onset was determined by visual observation of the appearance of abnormal limb-clasping, slight tremor felt in one of the hind-limbs, wobbly gait and the first signs of paralysis in one hind-limb. End disease stage was determined as the time at which an animal can no longer right itself within 30 s after being placed on its back as described (Hetz et al., 2007;Hetz et al., 2008). Collection of onset data began at five weeks when mice were trained for rotarod as described in Hetz, et. al 2008. Disease progression was monitored at least once per week until mice reached 90 days, from which point observations were made every 1-4 days. Parameters included rotarod, weight, and qualitative assessment of hind limb grasping, back arch, grooming behavior, and paralysis.
Onset was determined separately for rotarod, and body weight where the last measurement before a precipitous and sustained decline in the readout parameter was noted as the start of disease. Observational data defined duration of the disease from onset until the first day at which hind limb paralysis reached a minimum of 50%.

Tissue analysis. To monitor SOD1 pathogenesis in vivo, female animals were euthanized and tissue collected for histology at different time points depending on the analysis required. Spinal cord tissue was processed for immunohistochemistry using standard procedures as described (Hetz et al., 2007). Apoptotic cells in the ventral horn were quantified by using the TUNEL assay (Promega) as previously described (Hetz et al., 2007). Motoneurons were also directly visualized with anti-ChAT 1:50 or anti-NeuN 1:100 (Chemicon) staining as previously described (Hetz et al., 2007). In addition, staining of LC3 and lysosomes were performed with anti-LC3 1:100 (Cell Signaling Technology) and anti-LAMP-2 1:200 (Developmental Studies Hybridoma Bank). Staining of astrocytes was performed with an anti-GFAP antibody 1:400 (Chemicon or Jackson). Confocal microscopy was used to acquire images and then analysis was performed using the IP lab v 4.04 software (Beckon and Dickenson).

Western blot analysis of spinal cord extracts. 1 cm lumbar spinal cord tissue was collected and homogenized in RIPA buffer (20mM Tris pH 8.0, 150mM NaCl, 0.1% SDS, 0.5% DOC, 0.5% triton X-100) containing a protease inhibitor cocktail (Roche, Basel, Switzerland) by sonication. Protein concentration was determined by micro-BCA assay (Pierce, Rockford, IL). The equivalent of 30–50mg of total protein was loaded onto 4-12, 7.5, 12 or 15% SDS-PAGE minigels (Cambrex Biosciences) depending on the analysis as described above. The following antibodies and dilutions were used: anti-Grp78/Bip, anti-Grp58, anti-PDI, 1:2,000 (StressGene, San Diego, CA), anti-XBP-1, 1:2,000 (Biolegend), anti-GFP 1:1000, anti-Ubiquitin 1:2000, anti-ATF4, anti-Hsp90, anti-CHOP 1:2,000 (Santa Cruz, CA); anti-SOD1 1:3000 (Calbiochem), anti-LC3 1:500, anti-Beclin-1 1:2000, anti-ATG5 1:2000 (Cell Signaling Technology).

RNA extraction and RT-PCR. Total RNA was prepared from spinal cord tissue homogenated in cold PBS using Trizol (Invitrogen, Carlsbad, CA) and cDNA was synthesized with SuperScript III (Invitrogen, Carlsbad, CA) using random primers p(dN)6 (Roche, Basel, Switzerland). Quantitative real-time PCR reactions employing SYBR green fluorescent reagent were performed in an ABI PRISM 7700 system (Applied Biosystems, Foster City, CA). The relative amounts of mRNAs were calculated from the values of comparative threshold cycle by using b-actin as control. Primer sequences were designed by Primer Express software (Applied Biosystems, Foster City, CA) or obtained from the Primer Bank (http://pga.mgh.harvard.edu/primerbank/index.html). Real time PCR was performed as previously described(Lee et al., 2005) using the following primers: grp78/bip 5’-TCATCGGACGCACTTGGAA-3’ and 5’-CAACCACCTTGAATGGCAAGA-3’; grp58 5’- GAGGCTTGCCCCTGAGTATG-3’ and 5’-GTTGGCAGTGCAATCCAC C-3’; Chop/gadd153 5’-GTCCCTAGCTTGGCTGACAGA-3’ and 5’-TGGAGAGC GAGGGCTTTG-3’; xbp-1 5’-CCTGAGCCCGGAGGAGAA-3’ and.5’-CTCG AGCAGTCTGCGCTG-3’; pdi 5’- CAAGATCAAGCCCCACCTGAT-3’ and AGTTCGCCCCAACCAGTACTT; erdj4 5’- CCCCAGTGTCAAACTGTACCAG-3’ and 5’- AGCGTTTCCAATTTTCCATAAATT-3’; edem 5’- AAGCCCTCTGGAACTTGCG-3’ and 5’- AACCCAATGGCCTGTCTGG-3’; sec61a 5’- CTATTTCCAGGGCTTCCGAGT-3’ and 5’- AGGTGTTGTACTGGCCTCGGT-3’; herp 5’- CATGTACCTGCACCACGTCG-3’ and 5’- GAGGACCACCATCATCCGG-3’; actin 5’- TACCACCATGTACCCAGGCA-3’ and 5-‘ CTCAGGAGGAGCAATGATCTTGAT-3’; wfs-1 5'-CCATCAACATGCTCC CGTTC-3' and 5'-GGGTAGGCCTCGCCAT-3'; grp94, 5'-TGTATGTACGCCGCGTATTCA-3' and 5'-TCGGAATCCACAACACCTTTG-3'; atg5 5’-TGTGCTTCGAGATGTGTGGTT-3’ and 5’-GTCAAATAGCTGACTCTTGGCAA-3’

EM studies and immunogold staining. Autophagosomes were also visualized by transmission electron microscopy as in (Klionsky et al., 2008) and morphology examined as described in (Eskelinen, 2008). In addition, EM studies were carried out by the Harvard EM Core Facility and the P. Catholic University of Chile EM facility. Cells were fixed with 1.25% formaldehyde, 2.5% glutaraldehyde, 0.03% picric acid in 100mM sodium cacodylate buffer. After washing with 100mM sodium cacodylate buffer, tissues were treated for 1 h with 1% osmium tetroxide and 1.5% potassium ferrocyanide, and then 30 min with 0.5% uranyl acetate in 50mM maleate buffer, pH 5.15. After dehydration in ethanol, cells were treated for 1 h in propylenoxide and then embedded in Epon/Araldite resin. Ultrathin sections were collected on electron microscope grids and observed by using a JEOL 1200EX transmission electron microscope at an operating voltage of 60 kV.

For immuno-gold EM staining the conditions for labeling were established.to detect specific signals as we previously described (Court FA et al., 2008). Spinal cords were immersion fixed in 4% paraformaldehyde and 0,1% glutaraldehyde, cryoprotected in sucrose and frozen in liquid nitrogen. After thawing, the tissue was dehydrated in graded alcohol; embedded in LR white resin, and polymerized in a 60oC oven for 24 h. Pale gold ultrathin sections were collected on 200 mesh nickel grids. Grids with sections were blocked with 1% BSA in 1X PBS for one hour at room temperature and incubated with rabbit anti-LC3 (1:25, Cell Signaling Technologies) and sheep anti-SOD-1 (1:75, Calbiochem), 0,1% BSA in 1X PBS overnight at 4oC. Grids were washed and incubated with goat anti-rabbit IgG conjugated to 10 nm gold colloid (1:20, Ted Pella) and donkey anti-sheep IgG conjugated to 5 nm gold colloid (1:20, Ted Pella), 0,1% BSA in 1X PBS for 3 hours at room temperature; after washing, grids were fixed with 1% glutaraldehyde in 0,1M cacodylate buffer and air dried. Sections were contrasted with 1% uranyl acetate and lead citrate. Grids were examined with a Philips Tecnai 12 electron microscope operated at 80 kV. Negative films were developed and scanned.