LABORATORY MEASUREMENTS:
After blood samples were taken, plasma preserved with EDTA and serum were separated immediately by centrifugation at 2500 × g for 10 min.Glucose measurements involved the glucose oxidase method. Total cholesterol and total triglyceride levels were determined by enzymatic methods. HDL-C was measured in the supernatant after precipitation of apo B-containing lipoproteins with use of phosphotungstic acid and magnesium chloride. LDL-C level was calculated by use of the Friedewald formula. LDL-C was not calculated for individuals with triglyceride level >4.5 mmol/L. Serum concentration of insulin was determined by use of a radioimmunometric assay kit (Dongya Ltd, Beijing). Intra- and interassay coefficients of variation for insulin were 10% and 15%, respectively; no cross-reactivity was observed between insulin and proinsulin. Insulin resistance was assessed from glucose and insulin concentrations by the use of the homeostasis model assessment (HOMA) equation.
GENOTYPING
Genotyping of the TRIB3 R84 variant involved the RFLP-PCR method with the primers 5′- GGCCACCAAGCAGTCTCAC -3′ (forward) and 5′- CGCCCATGATCCCTAAGTTC -3′ (reverse). PCR conditions and protocols were as described by Prudente et al. Screening was performed by adding 1 unit of MspⅠrestriction enzyme into 15 μL of PCR product. After 2-h incubation at 37°C, products were loaded onto 1.5% agarosegel and visualized by staining with ethidium bromide.
CAROTID ULTRASONOGRAPHY
Ultrasound images were acquired by use of a 7.5-MHz linear array transducer and a commercially available ultrasound machine (Vivid 7 dimension;General Electric Medical Systems, Horten, Norway). Patients were in a supine position; the bilateralcarotid arteries were observed obliquely from the anteriorand posterior directions. The right and left common carotid arteries (CCAs) were examined with the head tilted slightly upward in the mid-line position. The transducer was manipulated so that the near and far walls of the CCAs were parallel to the transducer footprint, and the lumen diameter was maximized in the longitudinal plane. The reference point for measurement of the carotid intima-media thickness (IMT) was the region where the carotid bifurcations began. IMT, plaque extent of the near and far walls of the common and internal carotid arteries (ICAs)and bifurcations were measured according to the ACAPS protocol. The image on the scanner display was used for measurements. A thickened IMT was defined as ≥1.0 mm in either carotid artery. Presence of atheroscleroticplaques, defined as localized lesions with protrusion into thearterial lumen or regional IMT1.3mm, was considered when found in either or both CCAs.IMT was therefore measured at the point of maximal thickness in thewalls of both CCAs. Maximal and mean IMT were defined as the greatest and mean values, respectively, of IMT measured from 3 contiguous sites at 1-cm intervals. Maximal IMT represented the highest single measurement at any sitewith plaque. Both thickened IMT and plaques were reconfirmed byre-examining the lesions on the printouts from the ultrasoundscanner.
Supplemental Table A1.Demographic characteristics of the studied population
Characteristics / Control group（n=200） / MetS group
（n=217）
Sex (male/female) / 90/110 / 99/118
Age (years) / 51.34±9.68 / 52.73±9.00
BMI (kg/m2) / 23.43±2.91 / 29.00±4.16 **
WC (cm) / 84.21±8.51 / 98.15±10.12**
WHR / 0.86±0.06 / 0.93±0.06 **
SBP (mmHg) / 115.54±10.65 / 150.13±22.56 **
DBP (mmHg) / 75.21±6.87 / 93.59±14.18 **
TC (mmol/L) / 4.60±0.80 / 5.36±1.07**
TG (mmol/L) / 1.05±0.41 / 2.41±2.01**
HDL-C(mmol/L) / 1.54±0.34 / 1.25±0.40**
LDL-C(mmol/L) / 2.88±0.71 / 3.60±0.94 **
FBG (mmol/L) / 4.86±0.57 / 6.62±2.52**
Insulin (U/mL) / 10.67±4.78 / 20.46±10.82**
HOMA-IR / 2.34±1.22 / 6.13±4.30 **
Smoking (%) / 29% / 40%*
Drinking (%) / 23% / 34%*
Mean IMT (mm) / 053±0.15 / 0.76±0.17
Max IMT (mm) / 0.50(0.20) / 0.80(1.00)
Data are means ± SD unless otherwise indicated. *P<0.05, **P<0.001 vs control group.
Abbreviations: MetS, metabolic syndrome; BMI, body mass index; WC, Waist circumference; WHR, waist-to-hip ratio; SBP, systolic blood pressure; DBP, diastolic blood pressure; TC, total cholesterol; TG, triglycerides; HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density lipoprotein cholesterol; FBG, fasting blood glucose; HOMA-IR, homeostasis model assessment for insulin resistance; mean IMT, mean intima-media thickness; max IMT, maximum intima-media thickness.
Supplemental TableA2. Multivariate linear regression analysis of relation between the risk factors and carotid artery features
Risk factors / Standardized regression coefficient / PMean IMT
TRIB3 Q84R* / 0.099 / 0.026
SBP / 0.234 / 0.001
HDL / -0.138 / 0.004
WC / 0.217 / 0.001
Age / 0.277 / 0.001
Max IMT
TRIB3 Q84R* / 0.179 / 0.001
Age / 0.278 / 0.001
SBP / 0.120 / 0.038
WHR / 0.115 / 0.039
* QQ84 genotype=1, QR84 genotype=2, RR84 genotype=3;
Abbreviations: WC, Waist circumference; WHR, waist-to-hip ratio; SBP, systolic blood pressure; DBP, diastolic blood pressure; TC, total cholesterol; HDL-C, high-density lipoprotein cholesterol; mean IMT, mean intima-media thickness; max IMT, maximum intima-media thickness;