Identification of Potential Microrna-Target Pairs Associated with Osteopetrosisby Deep

Identification of potential microRNA-target pairs associated with osteopetrosisby deep sequencing, iTRAQproteomics and bioinformatics

Minglin Ou1, M.D.; Xiaoqing Zhang1, M.D.; Yong Dai1, Ph.D.; Jieying Gao1, Ph.D.; Mingsong Zhu1, M.S.; Xiangchun Yang1, M.S.; Yuchao Li1, M.D.; Ting Yang1, M.S.; Min Ding1*, M.D.

1Key Laboratory of Laboratory Medical Diagnostics, Ministry of Education, Chongqing Medical University, Chongqing, 400016, China.

* Correspondance should be addressed to Min Ding. E-mail: ; Telephone: +86-023-68485239; Fax: +86-023-68485992.

SUPPLEMENTARY METHODS

iTRAQ LC-MS-MS Analysis

One hundred micrograms of protein from each corresponding group pooled protein was digestedwith trypsin, and labeled according to the iTRAQ protocol (Applied Biosystems, Foster City, CA, USA). The labeled digests were combined into one sample mixture and reconstituted with 4 mL buffer A (25mM NaH2PO4 in 25% ACN, pH2.7). The fractionation was performed using LC-20AB HPLC Pump system (Shimadzu, Kyoto, Japan). The peptide in buffer A was loaded onto a 4.6 × 250 mm Ultremex SCX column containing 5-μm particles (Phenomenex, Torrance, CA, USA). The peptides is eluted at a flow rate of 1 mL/min with a gradient of buffer A for 10 min, 5-35% buffer B (25mM NaH2PO4, 1M KCL in 25% ACN, pH2.7) for 11 min, 35-80% buffer B for 1 min. The system was then maintained in 80% buffer B for 3 min before equilibrating with buffer A for 10 min prior to the next injection. Elution is monitoredby measuring absorbance at 214 nm, and fractions are collected every 1 min. The eluted peptides are pooled as 12 fractions, desalted by Strata X C18 column (Phenomenex, Torrance, CA, USA) and vacuum-dried. Each fraction was resuspended in certain volume of mobile phase A (2% ACN, 0.1% FA) and centrifuged at 20000g for 10min. The final average concentration of peptide in each fraction was 0.25μg/μL. The peptidewas then loaded on a splitless nanoACQuity (Waters, Milford, MA, USA) system coupled to the Triple TOF for analytical separation. Data acquisition was performed with a TripleTOF 5600 System (AB SCIEX, Concord, ON) fitted with a Nanospray III source (AB SCIEX, Concord, ON) and a pulled quartz tip as the emitter (New Objectives, Woburn, MA, USA).The MS data were processed using Proteome Discoverer Software (Version 1.2.0.208) (Thermo Scientific, Bremen, Germany) to generate the peak list.Mascot 2.3.02 (Matrix Science, London, United Kingdom) was used for theprotein identification, and the parameters as follows: Type of search: MS/MS Ion search; Enzyme: Trypsin; Fragment mass tolerance: ±0.1 Da; Mass values: Monoisotopic; Variable modifications: Gln->pyro-Glu (N-term Q), Oxidation (M), iTRAQ8plex(Y); Peptide mass tolerance: 0.05 Da; Instrument type:Defult; Max missed cleavages: 1; Fixed modifications: arbamidomethyl (C), iTRAQ8plex (N-term), iTRAQ8plex (K); Protein Mass: Unrestricted; Other parameters: default; Database, IPI_human v3.87 (91464 sequences).The search results were further filtered with the parameters as follows: for protein identification,significancethreshold:P0.05 (with 95% confidence), ion score or expected cutoff <0.05 (with 95% confidence); for protein quantitation,protein ratiotype: weighted; minimum precursor charge: 1; minimum peptides: 2 (unique peptides); median intensities: normalization (removed outliersautomatically). Proteins with 1.5 fold or more change betweenosteopetrosisgroup and the controlgroupwere determined as differentially expressed proteins.

Calculation of Pi, Pm1, Pc, and Pm2

The proportion of inversely expressedmiRNA and protein pairs that were computationallypredicted in the two sample groups was calculated as Pi=ni/Ni, whereni was the number ofinversely expressed miRNA and protein pairs that were computationally predicted, and Ni was the total number of computationally predicted miRNA and protein pairs; eight miRNAs were randomly selected from the 411 miRNAs found by deep sequencing, the proportion of inversely expressed miRNA and protein pairs that wererandomly selectedwas calculated as Pm1 =nm1/Nm1, wherenm1 was the number of inversely expressed miRNA and protein pairs that wererandomly selected, Nm1 was the total number of randomly selected miRNA and protein pairs. Similarly, The proportion of computationally predicted miRNA and protein pairs that wereinversely expressed was calculated as Pc=nc/Nc, where nc was the number ofcomputationally predicted miRNA and protein pairs that wereinversely expressed, and Nc was the total number ofinverselyexpressed miRNA and protein pairs; the proportion of computationally predicted miRNA and protein pairs that were randomly selected was calculated as Pm2 =nm2/Nm2, wherenm2 was the number ofcomputationally predictedmiRNA-target pairsthat were randomly selected, Nm2 was the total number of randomly selected miRNA and protein pairs.

SUPPLEMENTARY TABLES

Table S1miRNAs differentially expressed between osteopetrosis and controls

Name / Health control-std / Osteopetrosis-std / Fold-change (log2osteopetrosis/ control) / p-value
hsa-let-7g-5p / 40817.5375 / 16830.7834 / -1.27809 / 0
hsa-let-7i-3p / 0.4912 / 1.9056 / 1.955863 / 0.003200961
hsa-let-7i-5p / 7762.5824 / 3827.5687 / -1.02011 / 0
hsa-miR-122-5p / 0.2947 / 1.4292 / 2.277889 / 0.00541727
hsa-miR-1255a / 11.5925 / 5.3358 / -1.11942 / 7.96E-07
hsa-miR-1255b-5p / 2.5543 / 6.3839 / 1.32151 / 3.31E-05
hsa-miR-125a-5p / 27.606 / 12.6725 / -1.12328 / 1.97E-14
hsa-miR-125b-5p / 5.0103 / 2.2868 / -1.13157 / 0.001113768
hsa-miR-1260b / 0.0982 / 1.6198 / 4.043949 / 9.89E-05
hsa-miR-1262 / 1.6701 / 0.3811 / -2.13169 / 0.003473324
hsa-miR-1270 / 3.7332 / 0.9528 / -1.97017 / 2.43E-05
hsa-miR-1277-5p / 8.0558 / 1.9056 / -2.07978 / 9.92E-11
hsa-miR-1306-5p / 0.8842 / 3.8113 / 2.107839 / 9.18E-06
hsa-miR-1307-5p / 10.1189 / 42.4957 / 2.070264 / 8.67E-50
hsa-miR-130b-3p / 33.7952 / 70.6039 / 1.06293 / 1.45E-31
hsa-miR-130b-5p / 2.2596 / 0.9528 / -1.24582 / 0.019231005
hsa-miR-136-5p / 11.4943 / 1.2387 / -3.21402 / 4.71E-23
hsa-miR-139-5p / 17.9783 / 43.925 / 1.288786 / 6.28E-27
hsa-miR-142-3p / 91.7579 / 45.5447 / -1.01055 / 1.44E-37
hsa-miR-143-5p / 4.1262 / 12.4819 / 1.596952 / 1.95E-11
hsa-miR-148b-5p / 9.6277 / 3.9066 / -1.30128 / 4.11E-07
hsa-miR-150-3p / 105.2171 / 34.3015 / -1.61703 / 4.49E-87
hsa-miR-150-5p / 159.5448 / 424.5761 / 1.412062 / 1.24E-281
hsa-miR-151b / 2.2596 / 0.8575 / -1.39786 / 0.010567239
hsa-miR-152 / 425.9768 / 180.4639 / -1.23906 / 2.28E-232
hsa-miR-1537 / 1.8666 / 0.5717 / -1.70708 / 0.007453647
hsa-miR-15b-5p / 90.186 / 354.4486 / 1.974601 / 0
hsa-miR-16-1-3p / 1.1789 / 0.0953 / -3.62882 / 0.001518444
hsa-miR-16-5p / 550.4493 / 1388.7335 / 1.335088 / 0
hsa-miR-193a-5p / 2.9473 / 10.5763 / 1.843369 / 8.71E-12
hsa-miR-193b-5p / 13.8521 / 3.6207 / -1.93576 / 4.98E-16
hsa-miR-197-3p / 2.9473 / 8.1942 / 1.475209 / 3.07E-07
hsa-miR-199b-5p / 3.7332 / 10.7669 / 1.528118 / 1.63E-09
hsa-miR-19a-3p / 1.7684 / 0.4764 / -1.8922 / 0.005276565
hsa-miR-204-3p / 0.5895 / 2.0962 / 1.830213 / 0.003020198
hsa-miR-20b-3p / 7.2699 / 2.4773 / -1.55317 / 5.13E-07
hsa-miR-21-3p / 6.091 / 1.8104 / -1.75037 / 5.73E-07
hsa-miR-21-5p / 9243.4805 / 3804.0341 / -1.28091 / 0
hsa-miR-221-5p / 230.9667 / 532.6258 / 1.205437 / 1.24E-276
hsa-miR-223-5p / 149.0329 / 51.3569 / -1.537 / 6.08E-114
hsa-miR-23a-3p / 460.3615 / 2079.4319 / 2.17535 / 0
hsa-miR-23b-3p / 40.5739 / 136.0625 / 1.745646 / 4.97E-124
hsa-miR-24-3p / 423.226 / 919.4702 / 1.119375 / 0
hsa-miR-25-5p / 196.8767 / 88.231 / -1.15793 / 1.33E-97
hsa-miR-28-5p / 24.1675 / 11.815 / -1.03245 / 2.32E-11
hsa-miR-296-5p / 0.1965 / 2.5726 / 3.710626 / 1.29E-06
hsa-miR-299-5p / 0.5895 / 2.5726 / 2.125663 / 0.000274089
hsa-miR-29a-5p / 1.6701 / 0.5717 / -1.5466 / 0.018593522
hsa-miR-29b-3p / 202.28 / 52.8814 / -1.93552 / 2.68E-212
hsa-miR-30a-3p / 3.9297 / 1.6198 / -1.2786 / 0.001509335
hsa-miR-30a-5p / 36.6442 / 13.4347 / -1.44762 / 5.95E-27
hsa-miR-30e-5p / 198.1539 / 60.8851 / -1.70246 / 1.41E-174
hsa-miR-3141 / 1.8666 / 0.667 / -1.48465 / 0.0154627
hsa-miR-3174 / 0.5895 / 1.7151 / 1.540729 / 0.017997257
hsa-miR-3200-5p / 0.1965 / 1.0481 / 2.415175 / 0.015124182
hsa-miR-3202 / 4.9121 / 1.2387 / -1.98751 / 1.03E-06
hsa-miR-320a / 31173.1319 / 9897.9779 / -1.6551 / 0
hsa-miR-32-5p / 10.6101 / 2.7632 / -1.94103 / 1.20E-12
hsa-miR-331-3p / 0.7859 / 11.6244 / 3.886667 / 7.78E-27
hsa-miR-337-3p / 0.2947 / 1.8104 / 2.61899 / 0.000634491
hsa-miR-337-5p / 0.2947 / 1.2387 / 2.071508 / 0.01512505
hsa-miR-339-5p / 5.5015 / 12.7678 / 1.214613 / 3.46E-08
hsa-miR-33a-5p / 143.3349 / 35.7307 / -2.00415 / 4.50E-158
hsa-miR-342-5p / 124.3742 / 48.1174 / -1.37006 / 1.43E-80
hsa-miR-34c-5p / 6.3857 / 1.9056 / -1.7446 / 3.23E-07
hsa-miR-3613-3p / 0.9824 / 2.1915 / 1.157536 / 0.030497805
hsa-miR-363-5p / 6.091 / 2.1915 / -1.47476 / 9.92E-06
hsa-miR-365b-5p / 5.4033 / 1.6198 / -1.73803 / 2.84E-06
hsa-miR-3690 / 8.8418 / 28.5846 / 1.692826 / 2.69E-26
hsa-miR-369-5p / 2.0631 / 4.4782 / 1.118105 / 0.00237211
hsa-miR-374b-5p / 57.8645 / 220.1964 / 1.92804 / 2.64E-228
hsa-miR-376a-3p / 0.6877 / 2.5726 / 1.903376 / 0.000704081
hsa-miR-3916 / 0.9824 / 2.382 / 1.277791 / 0.01463301
hsa-miR-410 / 1.6701 / 5.4311 / 1.70131 / 4.10E-06
hsa-miR-411-3p / 0.4912 / 1.6198 / 1.721433 / 0.013044273
hsa-miR-423-3p / 191.8664 / 94.2338 / -1.02579 / 1.69E-78
hsa-miR-424-5p / 8.6453 / 31.443 / 1.862751 / 1.29E-32
hsa-miR-4286 / 0.01 / 2.6679 / 8.059561 / 5.79E-09
hsa-miR-433 / 47.8438 / 19.4375 / -1.29949 / 1.13E-29
hsa-miR-4425 / 2.2596 / 0.7623 / -1.56764 / 0.005395573
hsa-miR-4435 / 1.9648 / 4.0018 / 1.026267 / 0.007433328
hsa-miR-4446-3p / 28.2937 / 10.3857 / -1.44588 / 3.95E-21
hsa-miR-451a / 670.8938 / 1901.0642 / 1.502651 / 0
hsa-miR-452-5p / 13.3609 / 35.5401 / 1.411431 / 3.80E-25
hsa-miR-4536-5p / 1.6701 / 0.4764 / -1.80969 / 0.008605804
hsa-miR-4707-3p / 0.393 / 6.1933 / 3.978107 / 4.23E-15
hsa-miR-4732-5p / 6.091 / 19.6281 / 1.68817 / 1.83E-18
hsa-miR-4742-5p / 0.6877 / 2.5726 / 1.903376 / 0.000704081
hsa-miR-4785 / 0.2947 / 1.2387 / 2.071508 / 0.01512505
hsa-miR-486-3p / 22.8904 / 9.2423 / -1.30842 / 3.84E-15
hsa-miR-493-3p / 2.3578 / 0.3811 / -2.6292 / 7.46E-05
hsa-miR-495 / 55.9979 / 126.9155 / 1.180424 / 3.09E-65
hsa-miR-5187-5p / 19.3537 / 8.9565 / -1.1116 / 2.15E-10
hsa-miR-5189 / 5.1086 / 10.2904 / 1.010299 / 2.00E-05
hsa-miR-532-3p / 6.3857 / 23.2488 / 1.86424 / 1.52E-24
hsa-miR-543 / 137.5386 / 46.2117 / -1.57351 / 6.37E-109
hsa-miR-548am-5p / 0.393 / 1.7151 / 2.125691 / 0.003283037
hsa-miR-548au-5p / 0.2947 / 1.7151 / 2.540974 / 0.001095108
hsa-miR-548c-5p / 0.4912 / 2.1915 / 2.157536 / 0.00073285
hsa-miR-548e / 25.3464 / 9.3376 / -1.44066 / 5.42E-19
hsa-miR-548o-5p / 0.4912 / 2.1915 / 2.157536 / 0.00073285
hsa-miR-556-3p / 1.0807 / 3.9066 / 1.853947 / 3.62E-05
hsa-miR-5706 / 0.1965 / 1.1434 / 2.540729 / 0.008761389
hsa-miR-574-5p / 4.9121 / 1.6198 / -1.60052 / 2.59E-05
hsa-miR-576-5p / 0.9824 / 6.3839 / 2.700056 / 2.35E-11
hsa-miR-582-5p / 0.2947 / 1.3339 / 2.178332 / 0.00909229
hsa-miR-589-3p / 1.2771 / 4.0018 / 1.647778 / 0.000116649
hsa-miR-589-5p / 6.5822 / 2.8585 / -1.20331 / 8.46E-05
hsa-miR-628-3p / 8.7435 / 22.9629 / 1.393022 / 1.74E-16
hsa-miR-641 / 5.0103 / 1.6198 / -1.62908 / 1.68E-05
hsa-miR-643 / 1.1789 / 0.1906 / -2.62882 / 0.006204253
hsa-miR-652-3p / 5.698 / 12.2914 / 1.109122 / 4.82E-07
hsa-miR-652-5p / 0.1965 / 1.2387 / 2.656226 / 0.0050344
hsa-miR-654-5p / 2.6525 / 0.1906 / -3.79873 / 5.80E-07
hsa-miR-659-5p / 2.1613 / 0.8575 / -1.33369 / 0.015899565
hsa-miR-664-3p / 6.8769 / 27.6317 / 2.006494 / 1.09E-31
hsa-miR-708-5p / 3.4385 / 1.6198 / -1.08596 / 0.009213784
hsa-miR-766-3p / 1.5719 / 5.4311 / 1.788735 / 1.84E-06
hsa-miR-766-5p / 71.4218 / 25.1544 / -1.50555 / 6.24E-54
hsa-miR-92a-1-5p / 96.3753 / 41.1618 / -1.22736 / 2.98E-53
hsa-miR-940 / 0.393 / 1.5245 / 1.955735 / 0.00882511
hsa-miR-941 / 20.0413 / 6.9556 / -1.52673 / 1.42E-16
hsa-miR-99b-3p / 4.6174 / 2.0962 / -1.1393 / 0.001662435

Name, the name of known miRNAs; osteopetrosis-std, read counts of each identified miRNA in osteopetrosis library normalized to the total number of small RNA reads, and multiplied by a constant set to 1×106; Health control-std, read counts of each identified miRNA in health control library normalized to the total number of small RNA reads, and multiplied by a constant set to 1×106; Fold-change(log2 ratio), Fold-change(log2 osteopetrosis/control); p value ≤ 0.05 were considered significant.

Table S2 Novel candidate microRNAs in osteopetrosis library

Name / Arm / Sequence / miRNA Length (nt) / Precursor Length (nt) / Location / MFE / Count
miRNA-01 / 3' / TCGACTTGCTCGGGCCCGGCT / 21 / 73 / chr10:104402512:104402584:- / -34.0 / 14
miRNA-02 / 5' / AGAGGATTCCGAAGACTAGGCT / 22 / 80 / chr11:5901731:5901810:+ / -26.4 / 5
miRNA-03 / 5' / GTGCGTCAGGACCGGCTTGCAA / 22 / 78 / chr11:75295100:75295177:+ / -28.9 / 14
miRNA-04 / 5' / GAGGACCCTGCAGGAATGGACGT / 23 / 76 / chr11:122650500:122650575:+ / -33.7 / 25
miRNA-05 / 3' / TCTGGAGACTGGGAGTGTTTATT / 23 / 100 / chr11:134109772:134109871:+ / -26.1 / 6
miRNA-06 / 3' / GCGATGAGGACGTGGGGTCGTGAC / 24 / 96 / chr11:2421408:2421503:- / -42.4 / 5
miRNA-07 / 5' / TGGAGGGTGAGGAGTGGCTAT / 21 / 96 / chr11:64507268:64507363:- / -48.0 / 85
miRNA-08 / 5' / AGTGGCGGCTGCAGAAAGCGTGG / 23 / 89 / chr11:109292863:109292951:- / -53.9 / 7
miRNA-09 / 5' / TCAGGGAGAAAGAAGGGTTATT / 22 / 84 / chr11:122928619:122928702:- / -21.3 / 24
miRNA-10 / 3' / GAGAGCTCCGACTGCAGCTGC / 21 / 95 / chr11:133027217:133027311:- / -35.3 / 50
miRNA-11 / 3' / CTTGCAGGGCAGAGAGCAGAA / 21 / 69 / chr12:56391684:56391752:+ / -24.4 / 5
miRNA-12 / 3' / TTGTGGAAACAATGGTACGGCA / 22 / 92 / chr15:45493361:45493452:+ / -28.7 / 42
miRNA-13 / 5' / TTCTGGAGGGATGGGTAGGAGCC / 23 / 89 / chr16:1814046:1814134:+ / -42.9 / 12
miRNA-14 / 3' / GGCTCGTGGCCTGCAGTGGATG / 22 / 75 / chr16:30198251:30198325:+ / -31.5 / 6
miRNA-15 / 5' / TGACACTGTGGGGAACGTGCA / 21 / 83 / chr16:30198328:30198410:+ / -29.2 / 17
miRNA-16 / 5' / ACTGGCAAAAGGGTTTAGAACT / 22 / 81 / chr16:50830166:50830246:+ / -20.3 / 33
miRNA-17 / 3' / TCACGTCTGCGGCTGTCACGT / 21 / 93 / chr16:87887450:87887542:+ / -30.9 / 7
miRNA-18 / 5' / AGCAGGCAGGGATTGGGAGCAC / 22 / 68 / chr16:57843868:57843935:- / -39.3 / 7
miRNA-19 / 5' / TGTTGGGGATTCGGGTGGCCAGA / 23 / 75 / chr16:88943676:88943750:- / -28.8 / 10
miRNA-20 / 5' / GTGAGTGCGGGCTGGGCACAAGT / 23 / 73 / chr17:6347799:6347871:+ / -32.0 / 10
miRNA-21 / 5' / GGCAGAGAGGAGGAGAGAATTG / 22 / 75 / chr17:27192986:27193060:+ / -26.2 / 5
miRNA-22 / 5' / TCAGGGGATGGGAGTGACATG / 21 / 81 / chr17:72519035:72519115:- / -38.6 / 6
miRNA-23 / 5' / TTGGAGGGTGTGGAAGACATC / 21 / 85 / chr19:13051290:13051374:+ / -31.0 / 8
miRNA-24 / 5' / TGGGGGACGAGAGAGTGACAGTA / 23 / 87 / chr19:15575180:15575266:+ / -44.4 / 6
miRNA-25 / 5' / AGGGGACGGGATGGAGGAACAGA / 23 / 77 / chr19:35761280:35761356:+ / -35.6 / 6
miRNA-26 / 5' / TCCTGGAGCTGGGCAGATGGGA / 22 / 75 / chr19:2762628:2762702:- / -35.7 / 37
miRNA-27 / 5' / CCCTGGGGCTGGGCAGGCGGA / 21 / 73 / chr19:6736721:6736793:- / -36.1 / 8
miRNA-28 / 5' / CAGGGCAGAGGGCACAGGAATCT / 23 / 89 / chr1:43914205:43914293:+ / -38.4 / 15
miRNA-29 / 5' / TCAGGCCAGGCTGGGAGGATG / 21 / 70 / chr1:55784355:55784424:+ / -52.4 / 9
miRNA-30 / 3' / CCTGAGGATGCAAGGGACGGA / 21 / 97 / chr1:148000660:148000756:+ / -35.6 / 14
miRNA-31 / 3' / CCTGAGGATGCAAGGGACGGA / 21 / 97 / chr1:148247974:148248070:+ / -32.9 / 14
miRNA-32 / 3' / TGTTGGCAGGAGCAGAGGATGACT / 24 / 94 / chr1:32258026:32258119:- / -29.0 / 34
miRNA-33 / 5' / TTGAGGGGAGAATGAGGTGGAGA / 23 / 83 / chr1:43830309:43830391:- / -33.5 / 34
miRNA-34 / 5' / GAGCAGGAGGACGAGGTGCTGCT / 23 / 79 / chr1:145139417:145139495:- / -28.2 / 5
miRNA-35 / 3' / TGCCCGGCGGTGTGCGGCCACA / 22 / 84 / chr20:17486149:17486232:+ / -28.9 / 15
miRNA-36 / 5' / GCCGGCTGGGAGGTGAGTGCG / 21 / 98 / chr20:23342853:23342950:+ / -62.7 / 7
miRNA-37 / 5' / AGGGGCTGGGGTTTCAGGTTCT / 22 / 66 / chr20:62708302:62708367:- / -35.3 / 6
miRNA-38 / 3' / TGGGGCTGCGGTGGGTCGGGA / 21 / 90 / chr21:45209209:45209298:- / -46.6 / 10
miRNA-39 / 3' / GGAGGAACCTTGGAGCTTCGGCA / 23 / 91 / chr22:31556037:31556127:- / -45.3 / 83
miRNA-40 / 5' / AGAACTCTGAGGCCAGAGCCTGC / 23 / 80 / chr22:40831342:40831421:- / -38.7 / 5
miRNA-41 / 3' / GGGACACAGACCCCCTGACGGTG / 23 / 84 / chr22:41621146:41621229:- / -46.2 / 5
miRNA-42 / 5' / TAGGCCATTTTGGAAGCTGTTT / 22 / 84 / chr2:33498389:33498472:+ / -23.0 / 8
miRNA-43 / 5' / AGAGGAGGGTGGAGCAAGTGGT / 22 / 91 / chr2:68622734:68622824:+ / -31.8 / 111
miRNA-44 / 3' / TAGGCAGGTGGGAACGTTCTTT / 22 / 81 / chr2:192711606:192711686:+ / -37.1 / 5
miRNA-45 / 5' / ATGGGGACAGGGATCAGCATGGCA / 24 / 80 / chr2:219206629:219206708:+ / -36.7 / 12
miRNA-46 / 5' / TGTGAGGAAGAAGAGGATGGAA / 22 / 88 / chr2:232227329:232227416:+ / -37.4 / 8
miRNA-47 / 5' / GAGGGAACAGGGGCAGACTTCT / 22 / 78 / chr2:233438716:233438793:+ / -32.3 / 9
miRNA-48 / 3' / TTAACTCTGCGGACAGAACGGT / 22 / 77 / chr2:66666024:66666100:- / -29.5 / 10
miRNA-49 / 5' / GGACGAAATCCAAGCGCAGCT / 21 / 83 / chr3:49058056:49058138:+ / -40.7 / 6
miRNA-50 / 5' / ACTGGGATGAGGTAGAGGAGG / 21 / 84 / chr3:49843588:49843671:+ / -39.4 / 8
miRNA-51 / 5' / AAAGGGGACAGCTCACAGGATT / 22 / 75 / chr4:16229484:16229558:+ / -22.2 / 7
miRNA-52 / 3' / CCTGGACGGAGAGAGGAGGTGA / 22 / 81 / chr5:151138291:151138371:+ / -49.0 / 15
miRNA-53 / 5' / GATGAGGAGGATGAGGAGGATG / 22 / 79 / chr6:3616133:3616211:+ / -21.7 / 15
miRNA-54 / 5' / CGACGGGATGAAGGGCTAGGCT / 22 / 72 / chr6:13328870:13328941:+ / -25.6 / 9
miRNA-55 / 3' / TCGGGCGGGAGTGGTGGCTTTT / 22 / 85 / chr6:28918819:28918903:+ / -22.2 / 149
miRNA-56 / 5' / GAGCTGAGGATTGGGGAGCGGCGA / 24 / 82 / chr6:149638802:149638883:+ / -35.3 / 9
miRNA-57 / 3' / CCCCAGGGATGGAGAAAGGGC / 21 / 83 / chr6:31657938:31658020:- / -33.3 / 42
miRNA-58 / 5' / ACAGGGAGAGGAGGTAGAGGGA / 22 / 85 / chr6:31978120:31978204:- / -41.7 / 5
miRNA-59 / 5' / ACAGGGAGAGGAGGTAGAGGGA / 22 / 85 / chr6:32010854:32010938:- / -41.7 / 5
miRNA-60 / 5' / TGGGCAGGGGCTTATTGTAGGAGT / 24 / 87 / chr6:32137807:32137893:- / -30.1 / 284
miRNA-61 / 5' / TGGGCAGGGGCTTATTGTAGGAGT / 24 / 87 / chr6_apd_hap1:3452548:3452634:- / -30.1 / 284
miRNA-62 / 3' / TCGGGCGGGAGTGGTGGCTTTT / 22 / 85 / chr6_cox_hap2:437555:437639:+ / -22.2 / 149
miRNA-63 / 3' / CCCCAGGGATGGAGAAAGGGC / 21 / 83 / chr6_cox_hap2:3167557:3167639:- / -33.3 / 42
miRNA-64 / 5' / ACAGGGAGAGGAGGTAGAGGGA / 22 / 85 / chr6_cox_hap2:3481505:3481589:- / -41.7 / 5
miRNA-65 / 5' / TGGGCAGGGGCTTATTGTAGGAGT / 24 / 87 / chr6_cox_hap2:3608488:3608574:- / -30.1 / 284
miRNA-66 / 3' / CCCCAGGGATGGAGAAAGGGC / 21 / 83 / chr6_dbb_hap3:2943510:2943592:- / -33.3 / 42
miRNA-67 / 5' / ACAGGGAGAGGAGGTAGAGGGA / 22 / 85 / chr6_dbb_hap3:3263703:3263787:- / -41.7 / 5
miRNA-68 / 5' / ACAGGGAGAGGAGGTAGAGGGA / 22 / 85 / chr6_dbb_hap3:3290071:3290155:- / -41.7 / 5
miRNA-69 / 3' / TCGGGCGGGAGTGGTGGCTTTT / 22 / 85 / chr6_mann_hap4:222224:222308:+ / -22.2 / 149
miRNA-70 / 3' / CCCCAGGGATGGAGAAAGGGC / 21 / 83 / chr6_mann_hap4:3000828:3000910:- / -33.3 / 42
miRNA-71 / 5' / TGGGCAGGGGCTTATTGTAGGAGT / 24 / 87 / chr6_mann_hap4:3480631:3480717:- / -30.1 / 284
miRNA-72 / 3' / TCGGGCGGGAGTGGTGGCTTTT / 22 / 85 / chr6_mcf_hap5:222372:222456:+ / -22.2 / 149
miRNA-73 / 3' / CCCCAGGGATGGAGAAAGGGC / 21 / 83 / chr6_mcf_hap5:3037618:3037700:- / -33.3 / 42
miRNA-74 / 5' / ACAGGGAGAGGAGGTAGAGGGA / 22 / 85 / chr6_mcf_hap5:3357964:3358048:- / -41.7 / 5
miRNA-75 / 5' / ACAGGGAGAGGAGGTAGAGGGA / 22 / 85 / chr6_mcf_hap5:3390695:3390779:- / -41.7 / 5
miRNA-76 / 5' / TGGGCAGGGGCTTATTGTAGGAGT / 24 / 87 / chr6_mcf_hap5:3517636:3517722:- / -30.1 / 284
miRNA-77 / 3' / TCGGGCGGGAGTGGTGGCTTTT / 22 / 85 / chr6_qbl_hap6:222219:222303:+ / -22.2 / 149
miRNA-78 / 3' / CCCCAGGGATGGAGAAAGGGC / 21 / 83 / chr6_qbl_hap6:2951581:2951663:- / -33.3 / 42
miRNA-79 / 5' / ACAGGGAGAGGAGGTAGAGGGA / 22 / 85 / chr6_qbl_hap6:3271908:3271992:- / -41.7 / 5
miRNA-80 / 5' / TGGGCAGGGGCTTATTGTAGGAGT / 24 / 87 / chr6_qbl_hap6:3398827:3398913:- / -30.1 / 284
miRNA-81 / 3' / TCGGGCGGGAGTGGTGGCTTTT / 22 / 85 / chr6_ssto_hap7:259726:259810:+ / -22.2 / 149
miRNA-82 / 3' / CCCCAGGGATGGAGAAAGGGC / 21 / 83 / chr6_ssto_hap7:2988748:2988830:- / -33.3 / 42
miRNA-83 / 5' / ACAGGGAGAGGAGGTAGAGGGA / 22 / 85 / chr6_ssto_hap7:3310830:3310914:- / -41.7 / 5
miRNA-84 / 5' / ACAGGGAGAGGAGGTAGAGGGA / 22 / 85 / chr6_ssto_hap7:3343562:3343646:- / -41.7 / 5
miRNA-85 / 5' / TGGGCAGGGGCTTATTGTAGGAGT / 24 / 87 / chr6_ssto_hap7:3485535:3485621:- / -30.1 / 284
miRNA-86 / 5' / TGGGCGGCCACTTGACATCCTCT / 23 / 82 / chr7:128587281:128587362:- / -34.8 / 6
miRNA-87 / 5' / TCGGCTGTGTATCTCTGTGCC / 21 / 77 / chr7:142157342:142157418:- / -28.8 / 29
miRNA-88 / 3' / TTGCTGGGAAAGGGAGAAGTTCAT / 24 / 85 / chr8:1703286:1703370:- / -46.8 / 11
miRNA-89 / 3' / CATGGCACTGGAGTAGAGCAT / 21 / 94 / chr8:141181858:141181951:- / -33.5 / 10
miRNA-90 / 5' / GCGGGCGGACGAGCGGGCGGGA / 22 / 89 / chr8:144897778:144897866:- / -46.8 / 14
miRNA-91 / 5' / CCCTGGGGTTCTGAGGACATG / 21 / 93 / chr9:35710651:35710743:- / -39.0 / 1517
miRNA-92 / 3' / ACGTGCAGCGTAGGGGCTTTT / 21 / 91 / chr9:100684412:100684502:- / -28.8 / 8
miRNA-93 / 3' / TCTGTGGGAGGTGAGACGACGC / 22 / 89 / chr9:139527377:139527465:- / -32.2 / 51
miRNA-94 / 3' / TCTGTGGGAGGTGAGACGACGC / 22 / 82 / chr9:139527661:139527742:- / -38.5 / 51
miRNA-95 / 5' / AACTTTGGAATGTGGTAGGGTA / 22 / 99 / chrX:18651329:18651427:+ / -24.8 / 6
miRNA-96 / 5' / CGGCGGCAGCGGGAGCGACAG / 21 / 69 / chrX:48554902:48554970:- / -33.5 / 5

Name, name of novel miRNAs in osteopetrosis libraries; Sequence, miRNA sequence; Arm, miRNA location in the predicted hairpin structure 5’ or 3’ arm; miRNA Length, the length of miRNA; Precursor length, the length of precursor miRNA; Location, miRNA location in the chromosome; MFE, minimum free energy; Count, the counts of miRNA reads.

Table S3 Differentially expressed proteins between osteopetrosis and control

Accession / Gene Symbol / Protein / Score / Ratio / Protein Log2 Ratio
IPI00027430 / SPN / Leukosialin / 27 / 0.67 / -0.58
IPI00008223 / RAD23B / UV excision repair protein RAD23 homolog B / 105 / 0.4 / -1.32
IPI00220857 / CAST / Isoform 2 of Calpastatin / 520 / 0.61 / -0.71
IPI00221178 / TPD52L2 / Isoform 2 of Tumor protein D54 / 572 / 0.5 / -1.00
IPI00021812 / AHNAK / Neuroblast differentiation-associated protein AHNAK / 502 / 0.52 / -0.94
IPI00009123 / NUCB2 / Isoform 1 of Nucleobindin-2 / 256 / 0.62 / -0.69
IPI00029601 / CTTN / Src substrate cortactin / 374 / 0.49 / -1.03
IPI00002535 / FKBP2 / Peptidyl-prolyl cis-trans isomerase FKBP2 / 80 / 0.61 / -0.71
IPI00008527 / RPLP1 / 60S acidic ribosomal protein P1 / 182 / 0.53 / -0.92
IPI00216697 / ANK1 / Isoform Er1 of Ankyrin-1 / 119 / 0.61 / -0.71
IPI00163849 / EPS15L1 / Epidermal growth factor receptor substrate 15-like 1 / 205 / 0.63 / -0.67
IPI00023860 / NAP1L1 / Nucleosome assembly protein 1-like 1 / 485 / 0.57 / -0.81
IPI00013894 / STIP1 / Stress-induced-phosphoprotein 1 / 634 / 0.61 / -0.71
IPI00020060 / SLC9A1 / Isoform 1 of Sodium/hydrogen exchanger 1 / 148 / 0.5 / -1.00
IPI00396378 / HNRNPA2B1 / Isoform B1 of Heterogeneous nuclear ribonucleoproteins A2/B1 / 195 / 0.48 / -1.06
IPI00843765 / SPTAN1 / Isoform 3 of Spectrin alpha chain, brain / 348 / 0.62 / -0.69
IPI00215884 / SRSF / Isoform ASF-1 of Serine/arginine-rich splicing factor 1 / 299 / 0.65 / -0.62
IPI00418471 / VIM / Vimentin / 1972 / 0.48 / -1.06
IPI00000861 / LASP1 / Isoform 1 of LIM and SH3 domain protein 1 / 587 / 0.6 / -0.74
IPI00293126 / TBCB / Tubulin-folding cofactor B / 135 / 0.61 / -0.71
IPI00413778 / FKBP1A / FKBP1A protein / 165 / 0.54 / -0.89
IPI00022445 / PPBP / Platelet basic protein / 1804 / 0.51 / -0.97
IPI00444262 / NCL / Nucleolin / 88 / 0.48 / -1.06
IPI00045396 / CALU / Isoform 2 of Calumenin / 265 / 0.62 / -0.69
IPI00060181 / EFHD2 / EF-hand domain-containing protein D2 / 128 / 0.6 / -0.74
IPI00014572 / SPARC / Secreted protein, acidic, cysteine-rich (Osteonectin), isoform CRA_a / 947 / 0.65 / -0.62
IPI00013079 / EMILIN1 / EMILIN-1 / 622 / 0.64 / -0.64
IPI00220503 / DCTN2 / Isoform 2 of Dynactin subunit 2 / 309 / 0.66 / -0.60
IPI00442073 / CSRP1 / Cysteine and glycine-rich protein 1 / 236 / 0.32 / -1.64
IPI00289876 / STX7 / Isoform 1 of Syntaxin-7 / 142 / 0.57 / -0.81
IPI00013260 / LSP1 / Lymphocyte-specific protein 1 / 210 / 0.59 / -0.76
IPI00646909 / TUBA8 / Tubulin alpha-8 chain / 783 / 0.26 / -1.94
IPI00759644 / FKBP1A / Peptidyl-prolyl cis-trans isomerase FKBP1A isoform b / 159 / 0.62 / -0.69
IPI00220740 / NPM1 / Isoform 2 of Nucleophosmin / 359 / 0.5 / -1.00
IPI00026272 / HIST1H2AE / Histone H2A type 1-B/E / 309 / 0.1 / -3.32
IPI00395462 / C15orf63 / Isoform 2 of Huntingtin-interacting protein K / 81 / 0.53 / -0.92
IPI00021766 / RTN4 / Isoform 1 of Reticulon-4 / 249 / 0.27 / -1.89
IPI00219757 / GSTP1 / Glutathione S-transferase P / 650 / 0.66 / -0.60
IPI00012079 / EIF4B / Eukaryotic translation initiation factor 4B / 93 / 0.46 / -1.12
IPI00301058 / VASP / Vasodilator-stimulated phosphoprotein / 1119 / 0.66 / -0.60
IPI00013895 / S100A11 / Protein S100-A11 / 87 / 0.54 / -0.89
IPI00292134 / EPS15 / Isoform 1 of Epidermal growth factor receptor substrate 15 / 95 / 0.66 / -0.60
IPI00015891 / PFDN4 / Prefoldin subunit 4 / 117 / 0.58 / -0.79
IPI00021389 / CCS / Copper chaperone for superoxide dismutase / 208 / 0.63 / -0.67
IPI00003527 / SLC9A3R1 / Na(+)/H(+) exchange regulatory cofactor NHE-RF1 / 250 / 0.41 / -1.29
IPI00292290 / EPB49 / Isoform Long of Dematin / 229 / 0.56 / -0.84
IPI00220327 / KRT1 / Keratin, type II cytoskeletal 1 / 299 / 0.41 / -1.29
IPI00027463 / S100A6 / Protein S100-A6 / 77 / 0.49 / -1.03
IPI00001699 / PYCARD / Isoform 1 of Apoptosis-associated speck-like protein containing a CARD / 185 / 0.6 / -0.74
IPI00020194 / TAF15 / Isoform Short of TATA-binding protein-associated factor 2N / 41 / 0.55 / -0.86
IPI00022442 / NDUFAB1 / Acyl carrier protein, mitochondrial / 152 / 0.62 / -0.69
IPI00179330 / RPS27A / Ubiquitin-40S ribosomal protein S27a / 302 / 0.47 / -1.09
IPI00015262 / CNN2 / Calponin-2 / 194 / 0.65 / -0.62
IPI00007935 / PDLIM5 / Isoform 1 of PDZ and LIM domain protein 5 / 103 / 0.39 / -1.36
IPI00028888 / HNRNPD / Isoform 1 of Heterogeneous nuclear ribonucleoprotein D0 / 193 / 0.65 / -0.62
IPI00015029 / PTGES3 / Prostaglandin E synthase 3 / 291 / 0.3 / -1.74
IPI00217468 / HIST1H1B / Histone H1.5 / 254 / 0.61 / -0.71
IPI00180267 / C8orf42 / Conserved hypothetical protein / 57 / 0.28 / -1.84
IPI00008529 / RPLP2 / 60S acidic ribosomal protein P2 / 278 / 0.64 / -0.64
IPI00017731 / SEPT5 / Septin-5 / 107 / 0.48 / -1.06
IPI00218696 / CALD1 / Homo sapiens caldesmon 1 / 1059 / 0.61 / -0.71
IPI00296353 / ARHGAP18 / Isoform 1 of Rho GTPase-activating protein 18 / 191 / 0.62 / -0.69
IPI00289082 / PTPN12 / Tyrosine-protein phosphatase non-receptor type 12 / 276 / 0.56 / -0.84
IPI00031812 / YBX1 / Nuclease-sensitive element-binding protein 1 / 78 / 0.35 / -1.51
IPI00003406 / DBN1 / Isoform 1 of Drebrin / 427 / 0.59 / -0.76
IPI00216298 / TXN / Thioredoxin / 245 / 0.64 / -0.64
IPI00218733 / SOD1 / Superoxide dismutase [Cu-Zn] / 781 / 0.56 / -0.84
IPI00399183 / APOBR / Apolipoprotein B receptor / 232 / 0.33 / -1.60
IPI00289966 / IL16 / Isoform 3 of Pro-interleukin-16 / 115 / 0.49 / -1.03
IPI00005657 / PFDN6 / Prefoldin subunit 6 / 118 / 0.65 / -0.62
IPI00032826 / ST13 / Hsc70-interacting protein / 380 / 0.39 / -1.36
IPI00005688 / ZNF185 / Isoform 1 of Zinc finger protein 185 / 144 / 0.35 / -1.51
IPI00005981 / TAGLN3 / Transgelin-3 / 113 / 0.52 / -0.94
IPI00075248 / CALM3 / Calmodulin / 711 / 0.58 / -0.79
IPI00783862 / BLVRB / Flavin reductase / 86 / 0.47 / -1.09
IPI00217975 / LMNB1 / Lamin-B1 / 475 / 0.54 / -0.89
IPI00010779 / TPM4 / Isoform 1 of Tropomyosin alpha-4 chain / 2869 / 0.52 / -0.94
IPI00219953 / CMPK1 / UMP-CMP kinase isoform a / 48 / 0.46 / -1.12
IPI00976060 / CSRP1 / Uncharacterized protein / 380 / 0.56 / -0.84
IPI00217236 / TBCA / Tubulin-specific chaperone A / 180 / 0.65 / -0.62
IPI00013508 / ACTN1 / Isoform 1 of Alpha-actinin-1 / 4001 / 0.47 / -1.09
IPI00215965 / HNRNPA1 / Isoform A1-B of Heterogeneous nuclear ribonucleoprotein A1 / 352 / 0.54 / -0.89
IPI00654755 / HBB / Hemoglobin subunit beta / 4164 / 0.54 / -0.89
IPI00375441 / FUBP1 / Isoform 1 of Far upstream element-binding protein 1 / 58 / 0.46 / -1.12
IPI00221222 / SUB1 / Activated RNA polymerase II transcriptional coactivator p15 / 121 / 0.63 / -0.67
IPI00291930 / CLINT1 / Isoform 1 of Clathrin interactor 1 / 146 / 0.57 / -0.81
IPI00554761 / HMGN1 / Non-histone chromosomal protein HMG-14 / 141 / 0.54 / -0.89
IPI00030131 / TMPO / Isoform Beta of Lamina-associated polypeptide 2, isoforms beta/gamma / 102 / 0.42 / -1.25
IPI00410333 / TREML1 / Isoform 1 of Trem-like transcript 1 protein / 210 / 0.57 / -0.81
IPI00294962 / SH3KBP1 / Isoform 1 of SH3 domain-containing kinase-binding protein 1 / 132 / 0.53 / -0.92
IPI00026328 / TXNDC12 / Thioredoxin domain-containing protein 12 / 98 / 0.62 / -0.69
IPI00180404 / NEXN / Isoform 1 of Nexilin / 308 / 0.6 / -0.74
IPI00007277 / LRRFIP2 / Isoform 1 of Leucine-rich repeat flightless-interacting protein 2 / 182 / 0.59 / -0.76
IPI00012011 / CFL1 / Cofilin-1 / 1250 / 0.56 / -0.84
IPI00385149 / MIR1244-1 / MIR1244-1 Putative uncharacterized protein / 202 / 0.47 / -1.09
IPI00016620 / PSTPIP2 / Isoform 1 of Proline-serine-threonine phosphatase-interacting protein 2 / 163 / 1.69 / 0.76
IPI00927606 / GPX1 / Glutathione peroxidase 1 / 166 / 1.67 / 0.74
IPI00216308 / VDAC1 / Voltage-dependent anion-selective channel protein 1 / 96 / 2.1 / 1.07
IPI00017256 / RSU1 / Ras suppressor protein 1 / 688 / 2.04 / 1.03
IPI00418495 / CD36 / Platelet glycoprotein 4 / 167 / 1.55 / 0.63
IPI00031522 / HADHA / Trifunctional enzyme subunit alpha, mitochondrial / 218 / 1.63 / 0.70
IPI00328415 / CYB5R3 / Isoform 1 of NADH-cytochrome b5 reductase 3 / 274 / 2.92 / 1.55
IPI00019038 / LYZ / Lysozyme C / 263 / 2.13 / 1.09
IPI00002460 / ANXA7 / Isoform 1 of Annexin A7 / 100 / 2.39 / 1.26
IPI00028064 / CTSG / Cathepsin G / 144 / 2.03 / 1.02
IPI00027502 / GP9 / Platelet glycoprotein IX / 247 / 2.7 / 1.43
IPI00220642 / YWHAG / 14-3-3 protein gamma / 617 / 1.88 / 0.91
IPI01026172 / RAP1B / Uncharacterized protein / 520 / 4.1 / 2.04
IPI00219682 / STOM / Erythrocyte band 7 integral membrane protein / 655 / 2.53 / 1.34
IPI00019314 / C6orf25 / Isoform B of Protein G6b / 84 / 3.27 / 1.71
IPI00295976 / ITGA2B / Isoform 1 of Integrin alpha-IIb / 3178 / 2.37 / 1.24
IPI00216008 / G6PD / Isoform Long of Glucose-6-phosphate 1-dehydrogenase / 188 / 1.69 / 0.76
IPI00037448 / GRHPR / Glyoxylate reductase/hydroxypyruvate reductase / 81 / 1.5 / 0.58
IPI00022446 / PF4 / Platelet factor 4 / 186 / 1.78 / 0.83
IPI00025273 / GART / Isoform Long of Trifunctional purine biosynthetic protein adenosine-3 / 74 / 2.08 / 1.06
IPI00303476 / ATP5B / ATP synthase subunit beta, mitochondrial / 1266 / 2.23 / 1.16
IPI00004092 / ATP2A3 / Isoform SERCA3B of Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 / 551 / 2.04 / 1.03
IPI00027107 / TUFM / Elongation factor Tu, mitochondrial precursor / 447 / 1.99 / 0.99
IPI00299547 / LCN2 / Isoform 1 of Neutrophil gelatinase-associated lipocalin / 64 / 2.26 / 1.18
IPI00028091 / ACTR3 / Actin-related protein 3 / 406 / 1.6 / 0.68
IPI00219207 / RTN4 / Isoform 3 of Reticulon-4 / 92 / 2.74 / 1.45
IPI00014377 / RAB32 / Ras-related protein Rab-32 / 47 / 1.64 / 0.71
IPI00218918 / ANXA1 / Annexin A1 / 1132 / 1.72 / 0.78
IPI00008967 / TBXAS1 / Thromboxane-A synthase isoform 2 / 197 / 2.24 / 1.16
IPI00793199 / ANXA4 / Annexin A4 / 138 / 1.75 / 0.81
IPI00328867 / SRC / Isoform 2 of Proto-oncogene tyrosine-protein kinase Src / 199 / 1.5 / 0.58
IPI00177817 / ATP2A2 / Isoform 2 of Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 / 160 / 1.85 / 0.89
IPI00216293 / TST / Thiosulfate sulfurtransferase / 87 / 3.68 / 1.88
IPI00215914 / ARF1 / ADP-ribosylation factor 1 / 164 / 1.74 / 0.80
IPI00027497 / GPI / Glucose-6-phosphate isomerase / 187 / 1.58 / 0.66
IPI00027230 / HSP90B1 / endoplasmin precursor / 495 / 1.62 / 0.70
IPI00329801 / ANXA5 / Annexin A5 / 440 / 1.7 / 0.77
IPI00024145 / VDAC2 / Isoform 2 of Voltage-dependent anion-selective channel protein 2 / 173 / 2.48 / 1.31
IPI00291006 / MDH2 / Malate dehydrogenase, mitochondrial / 430 / 1.77 / 0.82
IPI00903112 / LTF / Lactotransferrin / 822 / 1.71 / 0.77
IPI00893981 / ACTB / ACTB Uncharacterized protein / 1245 / 5.29 / 2.40
IPI00016513 / RAB10 / Ras-related protein Rab-10 / 294 / 1.8 / 0.85
IPI00171573 / MCU / Isoform 1 of Calcium uniporter protein, mitochondrial / 78 / 2.3 / 1.20
IPI00305978 / AKR7A2 / Aflatoxin B1 aldehyde reductase member 2 / 66 / 1.81 / 0.86
IPI00215610 / MPP1 / 55 kDa erythrocyte membrane protein / 90 / 1.85 / 0.89
IPI00011107 / IDH2 / Isocitrate dehydrogenase [NADP], mitochondrial / 218 / 3.06 / 1.61
IPI00217966 / LDHA / Isoform 1 of L-lactate dehydrogenase A chain / 720 / 1.51 / 0.59
IPI00007188 / SLC25A5 / ADP/ATP translocase 2 / 136 / 2.62 / 1.39
IPI00645452 / TUBB / Uncharacterized protein / 995 / 3.91 / 1.97
IPI00290928 / GNA13 / Guanine nucleotide-binding protein subunit alpha-13 / 60 / 2.14 / 1.10
IPI00009309 / CCL5 / C-C motif chemokine 5 / 65 / 1.76 / 0.82
IPI00027462 / S100A9 / Protein S100-A9 / 400 / 2.16 / 1.11
IPI00218915 / ALOX12 / Arachidonate 12-lipoxygenase, 12S-type / 86 / 2.13 / 1.09
IPI00022774 / VCP / Transitional endoplasmic reticulum ATPase / 997 / 1.55 / 0.63
IPI00022937 / F5 / 252 kDa protein / 192 / 1.95 / 0.96
IPI00299571 / PDIA6 / Isoform 2 of Protein disulfide-isomerase A6 / 490 / 1.8 / 0.85
IPI00013219 / ILK / Integrin-linked protein kinase / 653 / 1.51 / 0.59
IPI00001754 / F11R / Junctional adhesion molecule A / 166 / 3.04 / 1.60
IPI01015923 / ITGB3 / Integrin beta / 1350 / 3.59 / 1.84
IPI01021925 / CS / Uncharacterized protein / 62 / 2.45 / 1.29
IPI00216171 / ENO2 / Gamma-enolase / 621 / 1.78 / 0.83
IPI00020191 / PTP4A2 / Isoform 1 of Protein tyrosine phosphatase type IVA 2 / 132 / 1.64 / 0.71
IPI00017895 / GPD2 / Isoform 1 of Glycerol-3-phosphate dehydrogenase, mitochondrial / 251 / 2.03 / 1.02
IPI00414320 / ANXA11 / Annexin A11 / 206 / 2.02 / 1.01
IPI00019376 / SEPT11 / Isoform 2 of Septin-11 / 84 / 1.6 / 0.68
IPI00021827 / DEFA3 / Neutrophil defensin 3 / 333 / 1.99 / 0.99
IPI00031804 / VDAC3 / Isoform 1 of Voltage-dependent anion-selective channel protein 3 / 103 / 2.96 / 1.57
IPI00464990 / GP1BB / Isoform 2 of Platelet glycoprotein Ib beta chain / 349 / 3.16 / 1.66
IPI00018146 / YWHAQ / 14-3-3 protein theta / 623 / 1.54 / 0.62
IPI00302925 / CCT8 / 59 kDa protein / 239 / 1.63 / 0.70
IPI00456925 / DBNL / Isoform 1 of Drebrin-like protein / 373 / 1.54 / 0.62
IPI00297550 / F13A1 / Coagulation factor XIII A chain / 1354 / 1.71 / 0.77
IPI00295618 / PECAM1 / Isoform Long of Platelet endothelial cell adhesion molecule / 521 / 1.84 / 0.88
IPI00337741 / APEH / Acylamino-acid-releasing enzyme / 103 / 1.5 / 0.58
IPI00296165 / C1R / Complement C1r subcomponent / 85 / 1.67 / 0.74
IPI00027444 / SERPINB1 / Leukocyte elastase inhibitor / 145 / 2.54 / 1.34
IPI00478231 / RHOA / Transforming protein RhoA / 302 / 1.71 / 0.77
IPI00217561 / ITGB1 / Isoform Beta-1C of Integrin beta-1 / 138 / 1.66 / 0.73

Accession, the accession protein in database ofInter-national Protein Index;Score, the score of protein identification; Ratio, average reporter ion ratio;Ratio ≥ 1.5 was classified as up-regulated, and ≤ 0.67 as down-regulatedwith p-value less than 0.05.

Table S4 Reciprocally expressed miRNAs and computationally predicted targets

miRNA / miRNA Log2 Ratio / Target symbol / Protein / Protein
Log2 Ratio / starBase
TargetScan / PicTar / RNA22 / PITA / miRanda
hsa-let-7i(3p) / 1.96 / CALD1 / Caldesmon 1 / -0.71 / Yes / Yes
hsa-let-7i(3p) / 1.96 / CALU / Isoform 2 of Calumenin / -0.68 / Yes / Yes
hsa-let-7i(3p) / 1.96 / PTPN12 / Tyrosine-protein phosphatase non-receptor type 12 / -0.84 / Yes / Yes
hsa-miR-122(5p) / 2.28 / CALM3 / Calmodulin / -0.78 / Yes / Yes / Yes / Yes
hsa-miR-130b(3p) / 1.06 / CMPK1 / UMP-CMP kinase isoform a / -1.11 / Yes / Yes / Yes / Yes
hsa-miR-130b(3p) / 1.06 / RTN4 / Isoform 1 of Reticulon-4 / -1.89 / Yes
hsa-miR-139-5p / 1.29 / CALM3 / Calmodulin / -0.78 / Yes
hsa-miR-139-5p / 1.29 / EIF4B / Eukaryotic translation initiation factor 4B / -1.12 / Yes
hsa-miR-139-5p / 1.29 / RTN4 / Isoform 1 of Reticulon-4 / -1.89 / Yes
hsa-miR-143(5p) / 1.60 / CALM3 / Calmodulin / -0.78 / Yes
hsa-miR-143(5p) / 1.60 / RTN4 / Isoform 1 of Reticulon-4 / -1.89 / Yes
hsa-miR-150(5p) / 1.41 / CAST / Isoform 2 of Calpastatin / -0.72 / Yes
hsa-miR-15b(5p) / 1.97 / CALU / Isoform 2 of Calumenin / -0.68 / Yes / Yes / Yes / Yes
hsa-miR-15b(5p) / 1.97 / CMPK1 / UMP-CMP kinase isoform a / -1.11 / Yes / Yes / Yes
hsa-miR-15b(5p) / 1.97 / HNRNPA1 / Isoform A1-B of Heterogeneous nuclear ribonucleoprotein A1 / -0.89 / Yes
hsa-miR-15b / 1.97 / HNRNPA2B1 / Isoform B1 of Heterogeneous nuclear ribonucleoproteins A2/B1 / -1.07 / Yes / Yes
hsa-miR-15b(5p) / 1.97 / LRRFIP2 / Isoform 1 of Leucine-rich repeat flightless-interacting protein 2 / -0.76 / Yes / Yes
hsa-miR-15b(5p) / 1.97 / RAD23B / UV excision repair protein RAD23 homolog B / -1.33 / Yes / Yes / Yes / Yes
hsa-miR-16(5p) / 1.34 / CALU / Isoform 2 of Calumenin / -0.68 / Yes / Yes / Yes / Yes
hsa-miR-16(5p) / 1.34 / CMPK1 / UMP-CMP kinase isoform a / -1.11 / Yes / Yes
hsa-miR-16(5p) / 1.34 / HNRNPA1 / Isoform A1-B of Heterogeneous nuclear ribonucleoprotein A1 / -0.89 / Yes
hsa-miR-16(5p) / 1.34 / HNRNPA2B1 / Isoform B1 of Heterogeneous nuclear ribonucleoproteins A2/B1 / -1.07 / Yes / Yes
hsa-miR-16(5p) / 1.34 / LRRFIP2 / Isoform 1 of Leucine-rich repeat flightless-interacting protein 2 / -0.76 / Yes / Yes
hsa-miR-16(5p) / 1.34 / RAD23B / UV excision repair protein RAD23 homolog B / -1.33 / Yes / Yes / Yes / Yes / Yes
hsa-miR-197(3p) / 1.48 / TXNDC12 / Thioredoxin domain-containing protein 12 / -0.69 / Yes
hsa-miR-199b-5p / 1.53 / RAD23B / UV excision repair protein RAD23 homolog B / -1.33 / Yes
hsa-miR-204(3p) / 1.83 / CALU / Isoform 2 of Calumenin / -0.68 / Yes
hsa-miR-221(5p) / 1.21 / CALM3 / Calmodulin / -0.78 / Yes
hsa-miR-221(5p) / 1.21 / CTTN / Src substrate cortactin / -1.04 / Yes
hsa-miR-221(5p) / 1.21 / HNRNPD / Isoform 1 of Heterogeneous nuclear ribonucleoprotein D0 / -0.62 / Yes
hsa-miR-221(5p) / 1.21 / RTN4 / Isoform 1 of Reticulon-4 / -1.89 / Yes
hsa-miR-24(3p) / 1.12 / CALM3 / Calmodulin / -0.78 / Yes
hsa-miR-24(3p) / 1.12 / TXNDC12 / Thioredoxin domain-containing protein 12 / -0.69 / Yes
hsa-miR-299-5p / 2.13 / RTN4 / Isoform 1 of Reticulon-4 / -1.89 / Yes
hsa-miR-337-5p / 2.07 / NUCB2 / Isoform 1 of Nucleobindin-2 / -0.69 / Yes
hsa-miR-374b / 1.93 / CALU / Isoform 2 of Calumenin / -0.68 / Yes
hsa-miR-374b(5p) / 1.93 / CMPK1 / UMP-CMP kinase isoform a / -1.11 / Yes
hsa-miR-374b(5p) / 1.93 / NAP1L1 / Nucleosome assembly protein 1-like 1 / -0.82 / Yes
hsa-miR-410 / 1.70 / RTN4 / Isoform 1 of Reticulon-4 / -1.89 / Yes / Yes
hsa-miR-411(3p) / 1.72 / STX7 / Isoform 1 of Syntaxin-7 / -0.81 / Yes
hsa-miR-424(5p) / 1.86 / CALU / Isoform 2 of Calumenin / -0.68 / Yes / Yes / Yes
hsa-miR-424(5p) / 1.86 / CMPK1 / UMP-CMP kinase isoform a / -1.11 / Yes
hsa-miR-424(5p) / 1.86 / HNRNPA2B1 / Isoform B1 of Heterogeneous nuclear ribonucleoproteins A2/B1 / -1.07 / Yes / Yes
hsa-miR-424(5p) / 1.86 / LRRFIP2 / Isoform 1 of Leucine-rich repeat flightless-interacting protein 2 / -0.76 / Yes
hsa-miR-424(5p) / 1.86 / PTGES3 / Prostaglandin E synthase 3 / -1.72 / Yes
hsa-miR-424(5p) / 1.86 / RAD23B / UV excision repair protein RAD23 homolog B / -1.33 / Yes / Yes / Yes
hsa-miR-452(5p) / 1.41 / HNRNPA2B1 / Isoform B1 of Heterogeneous nuclear ribonucleoproteins A2/B1 / -1.07 / Yes
hsa-miR-452(5p) / 1.41 / RAD23B / UV excision repair protein RAD23 homolog B / -1.33 / Yes
hsa-miR-495 / 1.18 / CALU / Isoform 2 of Calumenin / -0.68 / Yes
hsa-miR-495 / 1.18 / CAST / Isoform 2 of Calpastatin / -0.72 / Yes
hsa-miR-495 / 1.18 / RTN4 / Isoform 1 of Reticulon-4 / -1.89 / Yes
hsa-miR-532-3p / 1.86 / TAF15 / Isoform Short of TATA-binding protein-associated factor 2N / -0.87 / Yes / Yes
hsa-miR-548c-5p / 2.16 / RTN4 / Isoform 1 of Reticulon-4 / -1.89 / Yes
hsa-miR-548c-5p / 2.16 / SUB1 / Activated RNA polymerase II transcriptional coactivator p15 / -0.68 / Yes / Yes
hsa-miR-548o(5p) / 2.16 / HNRNPA2B1 / Isoform B1 of Heterogeneous nuclear ribonucleoproteins A2/B1 / -1.07 / Yes / Yes
hsa-miR-548o(5p) / 2.16 / LMNB1 / Lamin-B1 / -0.88 / Yes / Yes
hsa-miR-548o(5p) / 2.16 / VIM / VIM Vimentin / -1.06 / Yes
hsa-miR-576-5p / 2.70 / CMPK1 / UMP-CMP kinase isoform a / -1.11 / Yes
hsa-miR-576-5p / 2.70 / EFHD2 / EF-hand domain-containing protein D2 / -0.74 / Yes
hsa-miR-582-5p / 2.18 / LMNB1 / Lamin-B1 / -0.88 / Yes
hsa-miR-582-5p / 2.18 / RTN4 / Isoform 1 of Reticulon-4 / -1.89 / Yes / Yes
hsa-miR-628-3p / 1.39 / CALU / Isoform 2 of Calumenin / -0.68 / Yes
hsa-miR-628-3p / 1.39 / PTGES3 / Prostaglandin E synthase 3 / -1.72 / Yes
hsa-miR-664(3p) / 2.01 / PDLIM5 / Isoform 1 of PDZ and LIM domain protein 5 / -1.37 / Yes
hsa-miR-1277(5p) / -2.08 / RHOA / Transforming protein RhoA / 0.78 / Yes
hsa-miR-1277(5p) / -2.08 / GNA13 / Guanine nucleotide-binding protein subunit alpha-13 / 1.10 / Yes / Yes
hsa-miR-130b(5p) / -1.25 / RTN4 / Isoform 3 of Reticulon-4 / 1.45 / Yes
hsa-miR-130b(5p) / -1.25 / ATP5B / ATP synthase subunit beta, mitochondrial / 1.16 / Yes
hsa-miR-130b(5p) / -1.25 / HSP90B1 / Endoplasmin precursor / 0.70 / Yes
hsa-miR-142-3p / -1.01 / PDIA6 / Isoform 2 of Protein disulfide-isomerase A6 / 0.84 / Yes
hsa-miR-142-3p / -1.01 / RTN4 / Isoform 3 of Reticulon-4 / 1.45 / Yes
hsa-miR-148b(5p) / -1.30 / RTN4 / Isoform 3 of Reticulon-4 / 1.45 / Yes / Yes / Yes
hsa-miR-148b(5p) / -1.30 / HSP90B1 / Endoplasmin precursor / 0.70 / Yes / Yes / Yes
hsa-miR-152 / -1.24 / RTN4 / Isoform 3 of Reticulon-4 / 1.45 / Yes / Yes / Yes
hsa-miR-152 / -1.24 / ATP5B / ATP synthase subunit beta, mitochondrial / 1.16 / Yes
hsa-miR-152 / -1.24 / HSP90B1 / Endoplasmin precursor / 0.70 / Yes / Yes / Yes
hsa-miR-20b(3p) / -1.55 / ARF1 / ADP-ribosylation factor 1 / 0.80 / Yes
hsa-miR-20b(3p) / -1.55 / RTN4 / Isoform 3 of Reticulon-4 / 1.45 / Yes
hsa-miR-21(3p) / -1.75 / ATP5B / ATP synthase subunit beta, mitochondrial / 1.16 / Yes
hsa-miR-21(3p) / -1.75 / RTN4 / Isoform 3 of Reticulon-4 / 1.45 / Yes
hsa-miR-223(5p) / -1.54 / GPI / Glucose-6-phosphate isomerase / 0.66 / Yes
hsa-miR-223(5p) / -1.54 / HSP90B1 / Endoplasmin precursor / 0.70 / Yes
hsa-miR-25(5p) / -1.16 / ARF1 / ADP-ribosylation factor 1 / 0.80 / Yes
hsa-miR-25(5p) / -1.16 / GNA13 / Guanine nucleotide-binding protein subunit alpha-13 / 1.10 / Yes
hsa-miR-30a(5p) / -1.45 / YWHAG / 14-3-3 protein gamma / 0.91 / Yes
hsa-miR-30a(5p) / -1.45 / GNA13 / Guanine nucleotide-binding protein subunit alpha-13 / 1.10 / Yes / Yes
hsa-miR-30e(5p) / -1.70 / YWHAG / 14-3-3 protein gamma / 0.91 / Yes
hsa-miR-30e(5p) / -1.70 / ATP2A2 / Isoform 2 of Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 / 0.88 / Yes
hsa-miR-30e(5p) / -1.70 / GNA13 / Guanine nucleotide-binding protein subunit alpha-13 / 1.10 / Yes / Yes
hsa-miR-320a / -1.66 / ARF1 / ADP-ribosylation factor 1 / 0.80 / Yes / Yes / Yes / Yes / Yes
hsa-miR-320a / -1.66 / YWHAG / 14-3-3 protein gamma / 0.91 / Yes
hsa-miR-32(5p) / -1.94 / ARF1 / ADP-ribosylation factor 1 / 0.80 / Yes / Yes
hsa-miR-33a(5p) / -2.00 / RHOA / Transforming protein RhoA / 0.78 / Yes
hsa-miR-34c-5p / -1.74 / LDHA / Isoform 1 of L-lactate dehydrogenase A chain / 0.60 / Yes
hsa-miR-34c-5p / -1.74 / ANXA5 / ANXA5 Annexin A5 / 0.76 / Yes
hsa-miR-34c-5p / -1.74 / PDIA6 / Isoform 2 of Protein disulfide-isomerase A6 / 0.84 / Yes / Yes
hsa-miR-34c-5p / -1.74 / ATP5B / ATP synthase subunit beta, mitochondrial / 1.16 / Yes
hsa-miR-34c-5p / -1.74 / CYB5R3 / Isoform 1 of NADH-cytochrome b5 reductase 3 / 1.54 / Yes
hsa-miR-34c-5p / -1.74 / RTN4 / Isoform 3 of Reticulon-4 / 1.45 / Yes
hsa-miR-34c-5p / -1.74 / ARF1 / ADP-ribosylation factor 1 / 0.80 / Yes
hsa-miR-363(5p) / -1.47 / PTP4A2 / Isoform 1 of protein tyrosine phosphatase type IVA 2 / 0.71 / Yes
hsa-miR-363(5p) / -1.47 / ARF1 / ADP-ribosylation factor 1 / 0.80 / Yes
hsa-miR-433 / -1.30 / YWHAG / 14-3-3 protein gamma / 0.91 / Yes
hsa-miR-493(3p) / -2.63 / F11R / Junctional adhesion molecule A / 1.60 / Yes
hsa-miR-493(3p) / -2.63 / YWHAG / 14-3-3 protein gamma / 0.91 / Yes
hsa-miR-493(3p) / -2.63 / RTN4 / Isoform 3 of Reticulon-4 / 1.45 / Yes
hsa-miR-543 / -1.57 / PDIA6 / Isoform 2 of protein disulfide-isomerase A6 / 0.84 / Yes / Yes
hsa-miR-548e / -1.44 / RHOA / Transforming protein RhoA / 0.78 / Yes
hsa-miR-574-5p / -1.60 / PTP4A2 / Isoform 1 of protein tyrosine phosphatase type IVA 3 / 0.71 / Yes / Yes
hsa-miR-574-5p / -1.60 / SEPT11 / Isoform 2 of Septin-11 / 0.67 / Yes
hsa-miR-654-5p / -3.80 / RHOA / Transforming protein RhoA / 0.78 / Yes
hsa-miR-708(5p) / -1.09 / RTN4 / Isoform 3 of Reticulon-4 / 1.45 / Yes
hsa-miR-766(5p) / -1.51 / ARF1 / ADP-ribosylation factor 1 / 0.80 / Yes
hsa-miR-766(5p) / -1.51 / CYB5R3 / Isoform 1 of NADH-cytochrome b5 reductase 3 / 1.54 / Yes
hsa-miR-92a(5p) / -1.23 / ARF1 / ADP-ribosylation factor 1 / 0.80 / Yes / Yes
hsa-miR-99b(3p) / -1.14 / RAP1B / Uncharacterized protein / 2.03 / Yes
hsa-miR-99b(3p) / -1.14 / HSP90B1 / Endoplasmin precursor / 0.70 / Yes

miRNA Log2 Ratio, fold-change(log2osteopetrosis/control) analyzed by miRNA sequencing; Target gene symbol, gene symbol of miRNA target gene; Protein Log2 Ratio, fold-change(log2 osteopetrosis/control) analyzed by iTRAQ quantitative proteomic; “Yes”, indicates that the target has one or more predicted binding sites for the miRNA.