ONC-2012-02508R (revised)
April 23, 2013
Supplementary Information
GRIM-19 mutations fail to inhibitv-Src-inducedoncogenesis
Sudhakar Kalakonda£, Shreeram C Nallar£, Daniel J Lindner$, Peng Sun, Robert R Lorenz¶, Eric Lamarre¶, Sekhar P Reddy**, and Dhananjaya V Kalvakolanu*
Department of Microbiology & Immunology, Program in Oncology, GreenebaumCancerCenter, University of MarylandSchool of Medicine, Baltimore, MD21201
$Taussig Cancer Center, ¶Head & Neck Institute, Cleveland Clinic Foundation, Cleveland, OH 44195, **Department of Pediatrics, College of Medicine, University of Illinois at Chicago, Chicago, IL 60612.
Fig S1. Chromatograms showing the mutated residue in GRIM-19 ORF from squamous cell carcinoma. Wild-type GRIM-19 is included for comparison in each case.
Fig S2. Appearance of 3Y1 cell line expressing the indicated proteins under light microscopy. Live cell images are shown.
Fig.S3: Is similar to Fig.4A, except that Cortactin antibodies were used for immunofluorescence studies.
Fig S4. Immunofluorescent images of HSC3 cells expressing the indicated GRIM-19 protein. Nucleus (DAPI, Blue channel), GRIM-19 (FITC, Green channel) and Actin (Alexa Flour 555-conjugated Phalloidin, Red channel) are shown. Arrows indicate filopodia and lamellipodia like structures.
Effects of GRIM-19 mutants on v-Src-driven gene expression:
We checked for the transcript levels of STAT3-responsive genes in cells expressing v-Src and GRIM-19using real-time PCR. We chose Bcl2l1(Bcl2 member) and Ccnd1 (cyclin D1) as examples for this, given the involvement of these genes in anti-apoptotic and growth-promoting activities. Ccnd1levels were reduced to ~55% of v-Src-expressing cells by wild-type GRIM-19 (Fig.S5A). Cells expressing L71P and L91P had Ccnd1levels comparable to v-Src-expressing cells. Although, the A95T mutant could repress Ccnd1 levels, it could not repress Bcl2l1 like wild-type GRIM-19. The other mutants showed significant (p<0.05) loss of function compared to wild-type GRIM-19. A similar effect was seen in Western blot analyses for these proteins (Fig. S5B). However, a closer correlation between mRNA and protein levels was not evident. A basis for these differential effect(s) is unclear at this stage. Phosphorylation of Y705residue in STAT3has been implicated in driving v-Src-induced oncogenic responses. Hence, we checked whether these GRIM-19 mutants impacted v-Src-mediated STAT3 (Y705)phosphorylation (Fig. S5C).In wild-type GRIM-19-expressing cells, STAT3 (Y705) phosphorylation was strongly blocked. The L91P, L71Pand A95T mutantswere unable to block in v-Src-induced STAT3 tyrosyl phosphorylation.
Fig.S5: STAT3-responsive gene expression in v-Src-transformed cells. A) Steady-state transcript levels of STAT3-responsive gens in the indicated cell lines. The A95T mutant suppresses Ccnd1 levels (top panel) similar to wild-type GRIM-19 while it does not suppress Bcl2l1 levels (middle panel). Mutants L71P and L91P suppress Bcl2l1 levels similar to wild-type GRIM-19 while they are unable to suppress Ccnd1 levels. Sod2 transcripts levels (bottom panel) are suppressed to a similar extent by wild type and mutant GRIM-19. Data presented are avg ± sd from three independent RNA preparations. B) Western blot analysis of the indicated proteins normalized to actin levels in whole cell lysates. Protein levels do not strongly correlate to mRNA abundance. Data presented are avg ± sd (n = 3). C) Tyrosine705-phosphorylated STAT3 levels are comparable in L71P mutant and v-Src-expressing cells while mutants L91P and A95T are intermediary between v-Src and wild type GRIM-19-expressing cells. Data presented are avg ± sd (n = 5).
Table S1: Human GRIM-19 primers used in this study.
Primers to amplify the complete GRIM-19 mRNA for qualitative analysis.
GRIM-19 Fwd: 5’-GATACTGCGAGTATGGCG
GRIM-19 Rev: 5’-TTTTTTCCAGGTCTGCAGAGC
Primers to amplify and clone GRIM-19 ORF.
GRIM-19 Fwd: 5’ gcggaattcATGGCGGCGTCAAAGGTG
GRIM-19 Rev: 5’ gcgggatccCGTGTACCACATGAAGCCG
Table S2: Intronic primers to amplify individual human GRIM-19 exons.
Exon / Sense primer (5’→ 3’) / Anti-sense primer (5’→ 3’) / Size (bp)1 / ACTGTCCGGGACTTCCTAGC / aaactgaggcccgcctgtg / 298
2 / gagctgtggaggagggtgtc / gctacaggaccccgacaactc / 203
3 / ctgaggtctgtgctgcctgtgc / gtgcattctggccaccttcg / 239
4 / gaggcttgaaggggtgctac / ccttggtcctggggtttcta / 259
5 / gatgggtcctagcaggctg / ccccatgctacatgtgatcc / 337
Table S3: Gene-specific primers$ employed in real-time PCR.
Primer / Sense primer (5’→ 3’) / Anti-sense primer (5’→ 3’) / Size (bp)Pkm / ATGCTGGAGAGCATGATCAAGAAGC / GCACAGGGAAGATGCCACGGTAC / 431
Bcl2l1 / GCTGGTGGTTGACTTTCTCTC / CATCCAAACTGCTGCTGTG / 209
Ccnd1 / GAAAATCGTGGCCACCTGG / GTAGATGCACAACTTCTCGGC / 211
Stat3 / acttgggtggagaaggacatc / TTCTCAGCTCCTCACATGGGG / 450
Rpl32 / CGGAGAAGATTCAAGGGCCAG / CTTAGAGGACACATTGTGAGC / 183
$These primers can amplify human, mouse and rat gene products
1 | Page