Supplementary Information
Global gene response in Saccharomyces cerevisiae exposed to silver nanoparticles
Javed H. Niazi1,2,3, Byoung-In Sang2, Yeon Seok Kim1, Man Bock Gu1
1College of Life Sciences and Biotechnology, Korea University, Sungbuk-gu, Seoul, Rep. of Korea
2Center for Environmental Technology Research, Korea Institute of Science and Technology, Sungbuk-gu, Seoul, Rep. of Korea
3Faculty of Engineering and Natural Sciences, Sabanci Univesity, Orhanli, 34956 Tuzla, Istanbul, Turkey
Materials and methods
Real time RT-PCR
The primers and probe sets used in this study are shown in Table S1. The reverse transcription (RT) reaction mixture contained 2.5 µg of total RNA, 1X TaqMan RT buffer, 5.5 mM magnesium chloride, 500 µM of each dNTP, 2.5 µM olig-dT, 0.4 U µL-1 RNase inhibitor, and 1.25 U µL-1 MultiScribe reverse transcriptase in a total reaction volume of 100 µL. Amplification for RT was done as follows: initial incubation step at 25 ºC for 10 min, followed by a reverse transcription step at 48 ºC for 30 min and a reverse transcriptase inactivation step at 95 ºC for 5 min in a GeneAmp® PCR system 9700 (Applied Biosystems, USA). The real-time PCR reactions were performed in a MicroAmp optical 96-well plate using the ABI PRISM 7000 sequence detection system (Applied Biosystems) with a 1X TaqMan Universal PCR Master mix, 2.5 µL of total cDNA from the RT reaction sample, and the primers and probe sets for either the test genes (CUP1-1, YHR138C, and BOP2)or ACT1 (endogenous gene) in a total reaction volume of 30 µL. Amplification was carried out using the following program: incubation step at 50 ºC for 2 min, followed by Taq DNA polymerase activation at 90 ºC for 10 min and 40 cycles of 95 ºC for 15 sec and 60 ºC for 1 min.
The threshold cycle (Ct) values were obtained and these values were used to calculate the expressions of COP1-1, YHR138C, and BOP2 based on the formula, 2ΔCt test gene (control-test)/2ΔCt endogenous gene (control-test), where, ΔCT of endogenous ACT1 gene (control-test) represents CT value of the endogenous ACT1 gene of the control (untreated) – CT value of the endogenous gene from the test sample (chemical treated). The ΔCT value for the target genes COP1-1/ YHR138C/ BOP2 (control-test) represents CT value for the target genes (COP1-1/ YHR138C/ BOP2) in the control (untreated) sample – the CT value of the target genes (COP1-1/ YHR138C/ BOP2) in the treated sample [1, 2].
1
Table S1. Primers and probe sets used for confirmation of expression of CUP1-1, YHR138C, and BOP2 by real time RT-PCR. An housekeeping gene ACT1 was used as an endogenous control.
Gene / Forward primer (5'->3') / Reverse primer (5'-3') / aReporter probe (5'-3')ACT1 / AGCCGTTTTGTCCTTGTACTCTTC / CGTAAATTGGAACGACGTGAGTAAC / ACCATCACCGGAATCC
YHR138C (ID) / AGGGCTTTACAGTGGACTTACCT / ACTCGCTTTCAATATAGCTCAAACGT / ACCATCACCGGAATCC
CUP1-1 / GGTGTAACAGCGACGACAAATG / AGCATGACTTCTTGGTTTCTTCAGA / CCCCTGCGGTAACAAG
BOP2 / CGATACTGCATAAACTAACAACAAAGATAAAAACA / TGCTACTGTCGTTGTCGAGTTTAA / ATCCACGTCAAACTCA
aReporter probes were labeled at the 5’ end with the fluorescent reporter dye 6-carboxy-fluorescein (5’-FAM) and the 3’ end with a non-fluorescent quencher (NFQ).
Table S2. Summary of commonly expressed genes in S. cerevisiae 288C exposed to AgNPs and Ag-ions.
Gene ID / Gene / Expression fold / FunctionAgNPs / Ag-ion 120 min
120 min / 210 min
YHR053C / CUP1-1 / 39.4 / 45.3 / 22.6 / Metallothionein, binds copper and mediates resistance to high copper and cadmium
YHR055C / CUP1-2 / 36.8 / 42.2 / 21.1 / Metallothionein, binds copper and mediates resistance to high copper and cadmium
YBR296C / PHO89 / 26.0 / 1.9 / 5.7 / Na+/Pi cotransporter, active in early growth phase
YFL014W / HSP12 / 18.4 / 4.0 / 7.5 / Plasma membrane localized protein that protects membranes from desiccation
YBR072W / HSP26 / 8.6 / 3.0 / 3.2 / Small heat shock protein (sHSP) with chaperone activity
YHR087W / RTC3 / 7.5 / 3.2 / 5.7 / Protein of unknown function involved in RNA metabolism
YMR251W-A / HOR7 / 7.5 / 3.2 / 5.7 / Protein of unknown function
YGL156W / AMS1 / 6.5 / 3.2 / 3.0 / Vacuolar alpha mannosidase, involved in free oligosaccharide (fOS) degradation
YCR005C / CIT2 / 6.1 / 7.5 / 3.0 / Citrate synthase
YGL184C / STR3 / 5.7 / 4.6 / 7.0 / Cystathionine beta-lyase
YLR327C / TMA10 / 5.7 / 3.7 / 4.6 / Protein of unknown function that associates with ribosomes
YDR171W / HSP42 / 5.3 / 2.6 / 5.7 / Small heat shock protein (sHSP) with chaperone activity
YBR085C-A / - / 5.3 / 2.5 / 3.5 / Putative protein of unknown function
YNL036W / NCE103 / 5.3 / 3.0 / 3.7 / Carbonic anhydrase
YER103W / SSA4 / 5.3 / 2.1 / 6.5 / Heat shock protein that is highly induced upon stress
YDR034W-B / - / 4.9 / 3.5 / 2.5 / Protein of unknown function
YNL134C / - / 4.9 / 2.8 / 2.5 / Putative protein of unknown function with similarity to dehydrogenases
YGR032W / GSC2 / 6.5 / 4.6 / 1.1 / Catalytic subunit of 1,3-beta-glucan synthase, involved in formation of the inner layer of the spore wall
YKR053C / YSR3 / 4.6 / 4.6 / 1.6 / Dihydrosphingosine 1-phosphate phosphatase, a membrane protein
Table S3. Summary of differentially expressed genes in S. cerevisiae 288C exposed to AgNPs (140 M) at 120 min and their expression levels after 210 min of exposure. The genes listed in table were found to be normally expressed to Ag-ions after 120 min of exposure.
Gene ID / Gene name / Expression fold / Function120 min / 210 min
YHR138C / - / 4.0 / 1.5 / Unknown function
YKL103C / LAP4 / 3.7 / 1.6 / Vacuolar aminopeptidase (activated by Zn++)
YPL250C / ICY2 / 3.5 / 1.3 / Unknown function (interacting with cytoskeleton)
YCL040W / GLK1 / 3.5 / 1.1 / Glucokinase regulated by non-fermentable carbon sources
YNR050C / LYS9 / 3.5 / 0.9 / Saccharopine dehydrogenase (NADP+, L-glutamate-forming)
YBR056W / - / 3.2 / 1.5 / Putative cytoplasmic protein of unknown function
YLR178C / TFS1 / 3.0 / 1.5 / Carboxypeptidase Y inhibitor
YJR078W / BNA2 / 2.8 / 0.5 / Tryptophan 2,3-dioxygenase
YCL035C / GRX1 / 2.8 / 1.1 / Hydroperoxide and superoxide-radical responsive heat-stable disulfide oxidoreductase
YLR136C / TIS11 / 2.8 / 4.3 / mRNA-binding protein expressed during iron starvation; involved in iron homeostasis
YDL130W-A / STF1 / 2.6 / 0.9 / Protein involved in regulation of the mitochondrial F1F0-ATP synthase
YGL037C / PNC1 / 2.5 / 1.1 / Nicotinamidase that converts nicotinamide to nicotinic acid
YDR270W / CCC2 / 2.5 / 4.6 / Cu(+2)-transporting P-type ATPase, required for export of copper from the cytosol
YDL022W / GPD1 / 2.3 / 1.1 / NAD-dependent glycerol-3-phosphate dehydrogenase
YDR032C / PST2 / 2.3 / 0.9 / Protein with similarity to members of a family of flavodoxin-like proteins
YHR136C / SPL2 / 2.1 / 0.9 / Protein with similarity to cyclin-dependent kinase inhibitors
YDL021W / GPM2 / 2.1 / 1.0 / Homolog of Gpm1p phosphoglycerate mutase
YER091C / MET6 / 2.1 / 0.9 / Cobalamin-independent methionine synthase
YHL047C / TAF1 / 1.3 / 4.3 / Transporter, one of ARN family of transporters that specifically recognize siderophore-iron chelates
YOR382W / FIT2 / 1.3 / 4.6 / Involved in the retention of siderophore-iron in the cell wall
*Up-regulated genes that showed ≥2-fold expression either at 120 or 210 min of AgNP exposure are only listed in the table. Those highlighted in bold indicates genes differentially responded.
Table S4. Summary of differentially expressed genes in S. cerevisiae 288C exposed to Ag-ions for 120 min and comparison with their expression folds to AgNPs exposure after 120 and 210 min.
Gene ID / Gene name / Expression fold / FunctionAg-ions 120 min (unique) / AgNPs
120 min / 210 min
YOR382W / FIT2 / 2.1 / 1.3 / 4.6 / Involved in the retention of siderophore-iron in the cell wall
YLR267W / BOP2 / 4.3 / 2.0 / 3.0 / Protein of unknown function
YPL274W / SAM3 / 2.5 / 1.3 / 3.0 / High-affinity S-adenosylmethionine permease
YGL183C / MND1 / 3.0 / 1.6 / 2.6 / Protein required for recombination and meiotic nuclear division
YJL108C / PRM10 / 2.5 / 1.6 / 2.6 / Pheromone-regulated protein, predicted to have 5 transmembrane segments
YLR417W / VPS36 / 2.3 / 1.5 / 2.6 / Vacuolar Protein Sorting
YPR030W / CSR2 / 2.1 / 1.6 / 2.5 / Nuclear protein with a potential regulatory role in utilization of galactose and nonfermentable carbon sources
YDR258C / HSP78 / 4.0 / 1.3 / 2.3 / Oligomeric mitochondrial matrix chaperone (mitochondrial thermotolerance)
YPL223C / GRE1 / 2.6 / 1.3 / 2.3 / Hydrophilin of unknown function; stress induced (osmotic, ionic, oxidative, heat shock and heavy metals)
YGR121C / MEP1 / 3.7 / 1.6 / 2.1 / Ammonium permease; cytoplasmic membrane protein that transport only ammonium (NH4+)
YHR018C / ARG4 / 2.3 / 1.4 / 2.0 / Argininosuccinate lyase
YNL278W / CAF120 / 2.1 / 1.3 / 2.0 / Part of transcriptional regulatory complex
YPL156C / PRM4 / 2.1 / 1.5 / 2.0 / Pheromone-regulated protein
YHR104W / GRE3 / 2.3 / 2.0 / 1.4 / Aldose reductase; stress induced (osmotic, ionic, oxidative, heat shock, starvation and heavy metals)
YLR054C / OSW2 / 2.6 / 2.0 / 1.6 / Involved in the assembly of the outer spore wall (OSW)
YNR010W / CSE2 / 2.5 / 2.0 / 1.5 / Regulates RNA polymerase II activity
YOR185C / GSP2 / 2.3 / 2.0 / 1.2 / GTP binding protein involved in the maintenance of nuclear organization
*Only genes that showed ≥2 fold (Log2 ratio = ≥1) induction in at least one case are shown in the table.
1
References
1.Livak K. J., Schmittgen T. D. (2001). Methods, 25(4):402-8.
2.Pfaffl M. W., Gerstmayer B., Bosio A., Windisch W. (2003). J. Nutr. Biochem., 14(12):691-702.
Figure S1. Effect of various concentrations of (A) silver nanoparticles (AgNPs) and (B) silver ions (Ag-ions) on growth of S. cerevisiae 288C in YPD broth.
Figure S2. Gene induction folds of selected three candidate genes (CUP1-1, YHR138C, and BOP2) chosen to validate their responses by RT-qPCR analysis. The primers and probe sets are shown in Table S1 of Supplementary Information. The induction folds of the representative genes were obtained from an independent experiment to ascertain their expression patterns correlate to the results found in microarray analysis. The expression ratio’s of treated samples were calculated relative of their untreated samples and ACT1 was used as an endogenous control gene. The expression ratio of CUP1-1, YHR138C, and BOP2 gene calculated as 2ΔCt target gene (control – test)/2ΔCt endogenous gene (control – test).
1