Gel Electrophoresis Lab

Gel Electrophoresis Lab

(DNA Fingerprinting)

Notes From the teacher

Day 1:

Before class: Read the entire investigation. Complete the pre-lab for Part A and Part B:

1. Title
2. Purpose – general purpose for the whole lab
3. PreLab Questions for BOTH Parts A and B  copy the question and write the answer for each of the questions.

In class:

• Discuss Parts A and B of the lab
• Explain what we will be doing for Part C tomorrow, and that we are just setting up the lab stations today
• Complete the following:
• Obtain 6 clear micro test tubes and label their lids as follows:

CS – crime suspect

S1 – suspect 1

S2 – suspect 2

S3 – suspect 3

S4 – suspect 4

S5 – suspect 5

• Obtain the microtube floating rack. Label with your group names and block #.

• Get with your lab group and make sure you have all your necessary materials and practice loading the gels  Mrs. Willis will show you how to do this!

Day 2:

Before class: Complete the Pre-lab Questions for Part C based on what we have learned and completed so far. Write the Procedure for Part C. Instead of writing every step that is covered in the Quick Guide, you may tape the Quick Guide into your lab notebook.

In class:

• Obtain your micro test tubes that you labeled yesterday and an enzyme sample from the teacher. Make sure to keep the enzyme on ice.
• Work through Day 1 of the Quick Guide  Preparing the DNA Samples
• When you are done, put your samples in the container for your block and they will be placed in the fridge overnight

Day 3

Before class: N/A

In class:

• Work through Day 2 of the Quick Guide  Gel Electrophoresis
• Make sure to run your gel at 150V for approximately 40 minutes
• When it is done, put it in a staining tray and stain it overnight
• While the gel is running, create your own backstory for this lab as a group:
• What was the crime? Where did it occur? What happened? Who are the suspects and what are their motives? After you have this all set out, you will analyze your data (your gel) to see which of your suspects committed the crime.

Day 4:

Before Class: N/A

In class:

• Take your gel out of the stain and place it on a piece of paper.
• Get a piece of clear overhead (each person needs their own) and a sharpee marker.
• Trace your gel on the overhead (make sure to use a permanent marker!) Make sure to mark your wells, label them with number, and mark each band. You will use this picture to do the analysis for this lab. You need to TAPE THIS COPY OF YOUR GEL INTO YOUR LAB NOTEBOOK!
• Based on your gel, complete the Data Analysis Section and the Analysis Question Section for Part C of the lab.

GEL ELECTROPHORESIS LAB

BACKGROUND

Applications of DNA profiling extend beyond what we see on television crime shows. Are you sure that the hamburger you recently ate at the local fast-food restaurant was actually made from pure beef? DNA typing has revealed that often “hamburger” meat is a mixture of pork and other non-beef meats, and some fast-food chains admit to adding soybeans to their “meat” products as protein fillers. In addition to confirming what you ate for lunch, DNA technology can be used to determine paternity, diagnose an inherited illness, and solve historical mysteries, such as the identity of the formerly anonymous individual buried at the Tomb of the Unknown Soldier in Washington, D.C. DNA testing also makes it possible to profile ourselves genetically — which raises questions, including Who owns your DNA and the information it carries? This is not just a hypothetical question. The fate of dozens of companies, hundreds of patents, and billions of dollars’ worth of research and development money depend on the answer.

LEARNING OBJECTIVES

In this investigation, you will learn how to use restriction enzymes and gel electrophoresis to create genetic profiles. You will use these profiles to help solve a crime.

SAFETY PRECAUTIONS

Never handle gels with your bare hands. An electrophoresis apparatus can be dangerous because it is filled with a highly conductive salt solution and uses DC current at a voltage strong enough to cause a small shock. Always turn the power supply switch “OFF” and wait 10 seconds before making any connection. Connect BOTH supply leads to the power supply (black to black and red to red, just like when you jump-start a car battery) BEFORE turning on the power supply. Your teacher will tell you for how long and at how many volts you should run your gel. After use, turn off the power supply, and then disconnect BOTH leads from the power supply.

PART A  Restriction Enzymes

The DNA samples collected from the crime scene have been digested with restriction enzymes to generate smaller pieces of DNA, which will then be used to create DNA profiles of suspects.

Restriction enzymes are essential tools for analyzing DNA structure, and more than 200 enzymes are now available commercially. Each restriction enzyme is named for the bacterium in which it was first identified; for example, EcoRI was the first enzyme purified from Escherichia coli, and HindIII was the third enzyme isolated from Haemophilus influenzae. Scientists have hypothesized that bacteria use these enzymes during DNA repair and as a defense against their infection by bacteriophages. Molecular biologists use restriction enzymes to manipulate and analyze DNA sequences (Johnson 2009).

How do restriction enzymes work? These enzymes digest DNA by cutting the molecule at specific locations called restriction sites. Many restriction enzymes recognize a 4-10 nucleotide base pair (bp) palindrome, a sequence of DNA nucleotides that reads the same from either direction. Some restriction enzymes cut (or “cleave”) DNA strands exactly in the center of the restriction site (or “cleavage site”), creating blunt ends, whereas others cut the backbone in two places, so that the pieces have single-stranded overhanging or “sticky” ends of unpaired nucleotides.

Two pieces of DNA that are cut with the same restriction enzyme, creating either sticky or blunt ends, can be “pasted” together using DNA ligase by reconnecting bonds, even if the segments originated from different organisms. An example of combining two “sticky end” sequences from different sources is shown in Figure 1. The ability of enzymes to “cut and paste” DNA fragments from different sources to make recombinant DNA molecules is the basis of biotechnology.

Pre-Lab Questions for Part A:

1. What are some of the uses of DNA fingerprinting?
2. How do restriction enzymes work?
3. Where do restriction enzymes get their names from?
4. How do bacteria use restriction enzymes?
5. You have a piece of DNA with the following template strand. What is the sequence of the complementary DNA strand? Copy the template into your lab notebook and complete the complementary strand (remember, you are going from DNA to DNA here):

TEMPLATE  5’ –GCTGGAATTCACTGCATCGAATTCCCGGGGCTATATATGGAATTCGA -3’

COMP  3’ - - 5’

1. Assume you cut this fragment (the one from #5) with the restriction enzyme EcoRI. The restriction site for EcoRI is 5’GAATTC-3’, and the enzyme makes a staggered (“sticky end”) cut between G and A on both strands of the DNA molecule. Based on this information, draw an illustration showing how the DNA fragment is cut by EcoRI and the resulting products. In your lab notebook, use the strand (template and complementary) that you just completed and make a mark where the piece would be cut by EcoRI. It may cut in more than one spot!

Part B  DNA Mapping Using Restriction Enzymes

One application of restriction enzymes is restriction mapping. Restriction mapping is the process of cutting DNA at specific sequences with restriction enzymes, separating the fragments from each other by a process called gel electrophoresis (without pasting any fragments together), and then estimating the size of those fragments. The size and number of DNA fragments provide information about the structure of the original pieces of DNA from which they were cut.

Restriction mapping enables scientists to create a genetic signature or DNA “fingerprint” that is unique to each organism. The unique fragments, called restriction fragment length polymorphisms (RFLPs), can, for instance, be used to confirm that a mutation is present in one fragment of DNA but not in another, to determine the size of an unknown DNA fragment that was inserted into a plasmid, to compare the genomes of different species and determine evolutionary relationships, and to compare DNA samples from different individuals within a population. This latter application is widely used in crime scene investigations.

Consider your classmates. More than 99% of your DNA is the same as their DNA. The small difference is attributed to differences in your genetic makeup, with each person having a genetic profile, or “fingerprint”, as unique as the ridges, arches, loops, and grooves at the ends of his or her fingers.

Pre-Lab Questions for Part B:

1. What is restriction mapping?
2. Based on the information in the activity, can you make a prediction about the products of DNA from different sources cut with the same restriction enzymes?
3. What is a “DNA fingerprint”?
4. Can you make a prediction about the RFLP patterns of identical twins cut with the same restriction enzymes? How about the RFLP patterns of fraternal twins?

PART C  Gel Electrophoresis

Creating DNA profiles depends on gel electrophoresis. Gel electrophoresis separates charged molecules, including nucleic acids and amino acids, by how fast they migrate through a porous gel under the influence of an electrical current. Your teacher will likely prepare the agarose gel ahead of time by dissolving agarose powder (a gelatin-like substance purified from seaweed) in a current-carrying buffer. The gel solidifies around a comb placed at one end, forming wells into which you can load DNA fragments. You will prepare DNA fragments by exposing them to the restriction enzymes EcoRI and PstI. The DNA fragments you will be working with are DNA from a crime scene and the 5 suspects. You will also run a marker set of DNA (which will go in Lane 1 of your gel), which was cut with the enzyme HindIII, so that you can make a Standard Curve to help you determine the size of all the other fragments of DNA. Once all your DNA is prepared and loaded into your gel, you can turn on the gel chamber. When an electrical current is passed through the gel, the RFLPs (fragments or bands of DNA) migrate from one pole to the other. Gel electrophoresis can separate DNA fragments from about 200 to 50,000 base pairs (bp). The different pieces of DNA travel at different rates based on their size. The larger ones migrate more slowly, the smaller ones migrate more quickly. The wells are located at the negative end of the chamber and, when the electrodes are turned on, the DNA goes towards the positive end. This is because DNA is negatively charged and it is attracted to the positive end. Once the gel is done running, it will be taken out of the electrophoresis chamber and put in an overnight stain (Fast Blast DNA Stain) so that we can see the bands. The gel will be observed the following day and you will draw conclusions based on the banding pattern created.

Pre-Lab Questions for Part C:

1. What is gel electrophoresis?
2. Why do DNA fragments migrate through the gel from the negatively charged pole to the positively charged pole?
3. Which two restriction enzymes are used to digest the DNA samples?
4. Name the process used to separate fragments of DNA.
5. What type of gel will we use?
6. What will we use to stain our gel so that we can visualize the DNA bands?
7. When a molecule is put into an electrical field, name several factors which influence how quickly it travels.
8. Which molecule will move fastest through the gel, one of 100 nucleotides or one of 1000 nucleotides?

Procedure for Part C:

1. Label micro test tubes and floating test tube holder with your group initials and Block number.
2. Practice loading the gels using the pipettes and fake gels.
3. Obtain the enzyme and work through the Day 1 of the Quick Guide  Preparing the DNA Samples (see the Quick Guide for the specific procedure)
4. Work through the Day 2 of the Quick Guide  Gel Electrophoresis (see the Quick Guide for the specific procedure). Make sure to run at 150 V for about 40 minutes and then take the gel out and put it in the staining tray so it can stain overnight when you are done.
5. The next day, take the gel out of the tray using a spatula and carefully place it on paper towel. Blot it dry being cautious not to break it. Obtain a piece of overhead and use a sharpee marker to trace the gel (wells and bands) onto your piece of overhead. This will be your copy of the gel and you will use it to do your analysis. Make sure to label each well so you know what lane you are looking at. Tape this into your lab notebook.
6. Work through the Data Analysis Section of the Lab and complete Table 1: Electrophoresis Data, and the Standard Curve.
7. Complete the Analysis Questions. Copy the question into your lab notebook and answer it based on your data.
8. Be sure to include the Backstory for your group. This should be UPDATED with WHO committed the crime and each group member needs to have a copy printed out and taped into their lab notebooks.

Part C  Gel Electrophoresis  QUICK GUIDE (Procedure!)

7. Turn on the power and electrophorese your samples at 150 V for 30 minutes (maybe longer depending on how well they run).

8. When the electrophoresis is complete, turn off the power and remove the top of the gel box. Carefully remove the gel and tray from the gel box. Be careful – the gel is very slippery! Slide the gel into the staining tray.

9. Add 60 mL of DNA stain to the tray. Cover the tray with plastic wrap and let it sit overnight. Shake it periodically for best results.

Day 3 – Analysis of Gel

1. Pour stain out of staining tray and remove the gel using a spatula. Place the gel on a paper towel and carefully blot off.
2. Place a piece of clear overhead that has been cut to the size of the gel over the gel, and mark the wells and bands using a permanent marker. Make sure to number the wells as they appear on your gel. Everyone in the group needs to have their own copy of the gel so everyone needs to do this.

DATA ANALYSIS:

1. Measure the distance (in millimeters) that each fragment traveled from the well and record it in

Table 1 under each of the DISTANCE columns. Make sure to pay attention to which well you are measuring so that you are putting the correct information in the table. Keep in mind that some wells will have fewer than 6 bands (because they have less than 6 fragments of DNA).

Table 1. Electrophoresis Data

1. Create a Standard Curve  To make an estimate of the fragment sizes (how many base pairs are in the fragment), you must create a standard curve using the fragment information provided by the marker DNA. Using the data in the column Lambda/Hind III marker (you provide mm measurements, the basepair data is given to you), create a graph on the graph paper provided (see below). This is a line graph, not a best fit. It is possible you may have to re-label the mm measurements shown on the X axis to fit your data. Do so proportionately.
2. Determine the Size of Each Fragment for Each Suspect and Crime Scene  Check your data for the crime scene and the 5 suspects against the standard curve that you just made and fill in the approximate size of each fragment (in base pairs) on Table 1. NOTE: you are NOT making a curve from your data – your graph will only have ONE line on it from the marker…you will then use that curve to find out how big each of the other fragments are to fill in the data table.
3. Compare the fragment sizes of the crime scene and the 5 suspects and determine who committed the crime.

ANALYSIS QUESTIONS: Copy these questions in your lab notebook and then use your data to answer them.

1. What is the purpose of gel electrophoresis as demonstrated by this lab?