Supplementary Data
Supplementary Figures:
Figure S1. Related to Figure 1: Physiological properties of control neurons.
A. Current clamp recording from an hIPSC derived neuron showing regenerative action potential firing in response to depolarizing current injection. B. Voltage dependent currents elicited in response to depolarizing test potentials between -60mV and +20mV from a holding potential of -70mV. C. Spontaneous and miniature postsynaptic currents recorded in voltage clamp at a holding potential of -70mV in the absence (top panel) and presence of tetrodotoxin (bottom panel, TTX. D. Representative recordings at 0mV showing spontaneous (top panel) and miniature (middle panel) GABA mediated inhibitory postsynaptic currents.
Figure S2:SHANK3 patient neurons exhibit morphogenetic deficitsA. GFP transfected control neuron B. Tracing of the control neuron (Yellow: Neurites, Pink: Cell body outline, Green: secondary branches)C. GFP transfected SHANK3 neuron D. Tracing of SHANK3 neuron. (45 days neurons, Scale=250m).E. (i) No. of primary neurites per neuron (ii) Average neurite length (m). (iii) Average cell soma diameter (m). Significant differences were observed in all three parameters; data shown for day 45 neurons. Data presented as box plots with min and max, ***p<0.001, ***p<0.001, *** p<0.001 respectively. Mann-Whitney U test was performed. (Control neurons n=124; SHANK3 neurons n=106, from all 3 biological replicates. We compared 2 control lines with 2 SHANK3 lines, with one clonal replicate. F. (i) No. of primary neurites per neuron (ii) Average neurite length (m) (iii) Average cell soma diameter (m). (30 days neurons). Significant differences were observed in all the three parameters; data shown for day 30 neurons. Data presented as box plots with min and max, ***p<0.001, **p=0.0012, ***p<0.001 respectively; Mann-Whitney U test was performed. (Control neurons n=120; SHANK3 neurons n=122, from all 3 biological replicates. We compared 2 control lines with 2 SHANK3 lines, with one clonal replicate).
Figure S3. Related to Figure 1: A Western blot scan fluorescence intensity day day30. Data shown as mean±SD.***p<0.001, Unpaired student t test with Welch’s correction was performed. B(i). We compared the cell soma area after the overexpression of the SHANK3 P2 C1 rescue to SHANK3 P2 C1 myc only. Dunn’s Multiple comparison test revealed SHANK3 P2 C1 myc only vs. SHANK3 P2 C1 rescue ***p<0.001(ii). We compared the cell soma area after the overexpression of the SHANK3 P1 C2 rescue to SHANK3 P1 C2 myc only. Dunn’s Multiple comparison test revealed SHANK3 P1 C2 myc only vs. SHANK3 P1 C2 rescue ***p<0.001. The purpose of this experiment was to show that it is the SHANK3 gene that causes the rescue of morphogenetic phenotype and the only myc tag did not influence rescue effect. C(i) Average number of Synapsin puncta per 50 μm. Data represented as mean±SD. Data compared via unpaired student t test with Welch’s correction. ***p<0.001 control vs. shank3***p<0.001 shank3 vs shank3 rescue and ***p<0.001 shank3 rescue vs. shank3 myc only. H. Average number of Homer puncta per 50 μm. 2 control lines were compared to 2 SHANK3 lines. Data represented as mean±SD. Data compared via unpaired student t test with Welch’s correction. ***p<0.001 control vs. shank3, ***p<0.001 shank3 vs shank3 rescue and, ***p<0.001 shank3 rescue vs. shank3 myc only (SHANK3 patient neurons Synapsin rescue n=58, SHANK3 patient neurons Synapsin before rescue n=61, SHANK3 patient neurons Homer rescue n=50, SHANK3 patient neurons Homer before rescue n=46, control neurons Synapsin n=59 and control neurons Homer n=63, Shank3 myc only homer n=40, Shank3 myc only synapsin n=43, from all three biological replicates).
Figure S4. Related to Figure 2 and 3: A Rate of secondary branch formation (branch/hour). B. Rate of secondary branch elimination (branch/hour). Data represented as mean±SD. C. Day 30 CTIP2 and Tuj1 positive control neurons (Scale=25m). D. High content screening performed to find changes in cell soma area of day 30 cortical neurons. The Kolmogorov–Smirnov test was performed.
E. High content screening performed to find changes in number of primary neurons of day 30 cortical neurons. Data represented as box plots and the student t test was performed.Control neurons n=7.9x104; shank3 neurons n=4.9x104. We performed 3 biological replicates. We compared 3 control lines with 2 SHANK3 lines. No significant difference was found between patient and control cortical neurons. F. Using manual tracing we analyzed the average neurite length of day 30 control and patient cortical neurons. Data represented as mean±SEM. **p=0.0078, unpaired student t test, with Welch’s correction was performed. Control neurons n=87 Shank3 n=109 and we compared 2 control lines with 2 SHANK3 lines.
Figure S5 related to Figure 4: A (i) No. of primary neurites per neuron day25, (ii) day27. (iii) day30. Data represented as mean±SD. Data compared via. Unpaired student t test with Welch’s correction. Day 25 es shank3+/+ vs. es shank3+/- ***p<0.001, day 25 es shank3+/+ vs. es shank3-/- ***p<0.001, day 27 es shank3+/+ vs. es shank3 +/- ***p<0.001, day 27 es shank3+/+ vs. es shank3-/- ***p<0.001 and day 30 es shank3+/+ vs. es shank3+/- ***p<0.001, day 30 es shank3+/+ vs. es shank3-/- ***p<0.001. (es shank3+/+ n= 5.1X103, es shank3 +/-n=5.0X103, es-/- n=5.11X103 from all 3 biological replicates). B (i) shows the cumulative frequency distribution of cell soma area (m2) of day 25 neurons (ii) day27 neurons (iii) and day 30 neurons. Comparison were made using the Kolmogorov-Smirnov test as es shank3+/+ vs. es shank3+/- and es shank3+/+vs. es shank3-/- for day 25, 27 and 30. Day 25 es shank3+/+ vs. es shank3+/- ***p<0.001, day 25 es shank3+/+ vs. es shank3-/- ***p<0.001, day 27 es shank3+/+ vs. es shank3+/- ***p<0.001, day 27 es shank3+/+ vs. es shank3-/- ***p<0.001 and day 30 shank3 es+/+ vs. es shank3+/- ***p<0.001, day 30 es shank3+/+ vs. es shank3-/-**p<0.001.C(i) and (ii) SHANK3 P2 C3 and SHANK3 P1 C1 were rescued with the overexpression of SHANK3. The number of neurites per neuron were rescued in the female patient but not in the male as shown in the results Fig4.Data represented as mean±SD. Data compared via unpaired student t test with Welch’s correction. (**p=0.0083 SHANK3 P2 C3 before vs. SHANK3 P2 C3 after).
Figure S6 related to methods. A. Full length human SHANK3 ORF with N terminal Myc tag cloned into lentiviral backbone. B. Myc tag only without SHANK3.
Figure S7 Related to Figure4 and 5: Verification of SHANK3 overexpression virus via immunohistochemistry (Day 30 neurons). A(I) SHANK3 P2 C1 neuron transduced with Human SHANK3 ORF virus stained with (ii) DAPI, (iii)SHANK3 and (iv) SHANK3MYC. The arrow indicates the overlapping of SHANK3 antibody with Myc antibody. The arrow indicates the overlapping of SHANK3 antibody with Myc antibody. B(I) SHANK3 P2 C1 neuron transduced with only Myc virus stained with (ii) DAPI, (iii)SHANK3 and (iv) Only Myc. The arrow indicates no overlapping of SHANK3 antibody with Myc antibody. Scale=20µm.
Figure S8.Error rate by theCellomics NX11110. A. DCX positive neurons, the yellow arrow depicting the cell that has been false read. Yellow arrow showing the tracing of the false read neuron; it included the area next to cell soma. These type of cells were excluded from the data. B. Histogram showing the manual-count for different cell soma area bins. Please note that the picture depicted here (in A) is a representation of the machine while reprogramming. The Cellomics(NX11110) doesnot take high-resolution images and no scale is provided for the raw images. C. The average error rate percentage for the false positive cell shown by the cell insight.
Figure S9: SHANK3 expression in ES SHANK3 -/- and ES SHANK3 +/-. A qPCR was used spanning the entire transcript. The gene disruption cassette led to a 3’-terminal truncation of the transcript in the two homozygous lines (ΔC/ ΔC), as intended, with intermediate effect in the two heterozygous lines (+/ΔC). Since the cassette went in at the 5’ end of the largest exon 21, the targeted allele is expected to be a functional null.
Figure S10: Overexpression of SHANK3 increases synaptic punctas in SHANK3 patient neurons: A. SHANK3 patient neuron before rescue positive for Homer1(red) Myc (green) dapi (blue). B. SHANK3 patient neuron after rescue positive for Homer1 (red) Myc (green) dapi (blue). C. SHANK3 patient neuron before rescue positive for Synapsin(red) Myc (green) dapi (blue). D. SHANK3 patient neuron after rescue positive for Synapsin (red) (ii) Myc (green) dapi (blue). Scale=5 μm. E. Average number of Synapsin puncta per 50 μm. Data represented as Mean±sd. Data compared via unpaired student t test with Welch’s correction. ***p<0.001 control vs. shank3 and ***p<0.001shank3 vs. shank3 rescue. F. Average number of Homer1 puncta per 50 μm. Two control lines were compared to two SHANK3 lines. Data represented as Mean±sd. Data compared via unpaired student t test with Welch’s correction. ***p<0.001 control vs. shank3 and ***p<0.001 shank3 vs. shank3 rescue (SHANK3 patient neurons Synapsin rescue n=58, SHANK3 patient neurons Synapsin before rescue n=61, SHANK3 patient neurons Homer1 rescue n=50, SHANK3 patient neurons Homer1 before rescue n=46, control neurons Synapsin n=59 and control neurons Homer1 n=63, from all three biological replicates).
Figure S11: Related Figure 5, A and B Control and SHANK3 neurons stained with synapsin and homer at day 60 of neuralisation. Scale=10m and 7.5m respectively. No. of synapsin per 50m and No. of Homer punctas per 50m. ***p<0.001,***p<0.001, Unpaired student t test with Welch’s correction was performed. C and D. Western Blots of cortactin and Densin-180.
Supplementary Movies:
Movie1 is control neurons picture taken every hour for 24 hours. Movie 2 is shank3 neurons picture taken every hour for 24 hour.
Supplementary Tables:
TaqMan Probe / Average CNV value for control / Average CNV value for SHANK3 Patient 1 / Average CNV value for SHANK3 patient 2Probe Intron 2 / 1.91 / 1.74 / 1.6
Probe Intron 3 / 2.04 / 2.12 / 2.38
Probe exon 5 / 2.05 / 1.02 / 0.9
Probe intron 13 / 1.98 / 1.31 / 0.495
Probe ACR gene / 2.05 / 1.41 / 0.9775
TaqMan Probe / Chromosome Position / Amplicon Length / Sequence
Probe int2 / Chr.22:51114281 / 98 / TGTGTGCAGTGTGGGCTGTGTGCCACA
Probe int3 / Chr.22:51115993 / 110 / GGCCTTGGCACTATGGCTGGGCAGA
Probe ex5 / Chr.22:51117256 / 102 / GCTAAAGGTGCTGAAGAATGGTGGT
Probe int13 / Chr.22:51137625 / 105 / TGAGAAAAGAGCGTTTTTCCAAAGT
Probe ACR / Chr.22:51174223 / 81 / ACAGCATGAAGAAGGTCAGACAAAG
Table S1 Related to Figure 1: Taqman probes and their values: Table below describes the taqman probes for the SHANK3 gene and their sequence.
Table above describes the values obtained for each probe for control gDNA, SHANK3 patient 1 and 2. The probe value between 1.5 to 2 is considered as both copies of SHANK3 are being expressed, while values less than 1.5 is considered as deletion as only one copy of SHANK3 is being expressed. For both patients, it is evident that after probe exon 5, there is only one copy of SHANK3 being expressed the other is deleted. The RABL2 gene could not be assessed via TaqMan assay as this region is highly GC rich. For this I used, qPCR RABL2 primer, which gave the mean CNV value of 2.08 for SHANK3 patient 1 and 1.44 for SHANK3 patient 2. This suggested that SHANK3 patient 1 has a heterozygous deletion in SHANK3 from exon 4 onwards to ACR while SHANK3 patient 2 has a heterozygous deletion in SHANK3 that stretches from exon4 to RABL2. RABL2 forward primer sequence: ACGCTCTTTGATCTGCCTTC and reverse primer CCCTGGAGTTTTGGTTTGTC.
Table S2: Cell Lines: The cell lines used in this study
Cell Line Name / iPSC Line Name / Patient DetailsControl Patient 1 Clone 1
Control P1 C1 / Control Male 242
CM242 / Healthy Control Male
Control Patient 1 Clone 2
Control P1 C2 / Control Male 205
CM205 / Healthy Control Male
Control Patient 2 Clone 1
Control P2 C1 / Control Male 322
CM322 / Healthy Control Male
Control Patient 2 Clone 2
Control P2 C2 / Control Male 315
CM315 / Healthy Control Male
Control Patient 2 Clone 3
Control P2 C3 / Control Male m336s
CM336s / Healthy Control Male
Control Patient 3
Control P3 / Control Female
CF102 / Healthy Control Female
Control Patient 4
Control P4 / Control Female
CF405 / Healthy Control Female
Control Patient 5
Control P5 / Control Male
CM104 / Healthy Control Male
SHANK3 Patient 1
SHANK3 P1 C1 / SHANK3 Male
SHANK3 M103 / SHANK3 deleted Male Patient
SHANK3 Patient 2
SHANK3 P1 C2 / SHANK3 Male
SHANK3 M107 / SHANK3 deleted Male
Patient
SHANK3 Patient 2
SHANK3 P2 C1 / SHANK3 Female
SHANK3 F109 / SHANK3 deleted Female Patient
SHANK3 Patient 2
SHANK3 P2 C2 / SHANK3 Female
SHANK3 F107 / SHANK3 deleted Female Patient
SHANK3 Patient 2
SHANK3 P2 C3 / SHANK3 Female
SHANK3 F103 / SHANK3 deleted Female Patient
Table S3: Primary antibodies
Antibody Used / Species/ Dilution / CompanyTuj1 (Neuronal specific Biii tubulin) / Mouse/1 in 1000 / Covance
# MMS-435P
DCX (Double cortin) / Rabbit/ 1in 500 / AbCam
ab18723
CRH / Sheep/ 1 in 100 / Novus Biologicals
AF5805
GnRh1 / Rabbit/ 1 in 500 / Atlas
HPA027532
Shank3 / Rabbit/ 1 in 100 / Atlas
Myc / Mouse/ 1 in 5000 / Cell signaling 2276
Anti GFP / Chicken/ 1 in 500 / AbCam
ab13970
Synapsin / Rabbit/ 1 in 300 / Cell signaling 5297
Synaptophysin / Mouse/ 1 in 300 / AbCam
ab8049
MAP2 / Chicken/ 1 in 1000 / Anti-MAP2 antibody (ab5392)
CTIP2 / Rat/ 1 in 500 / AbCam
ab18465
Homer / Chicken/ 1 in 100 / Synaptic systems
160006
Homer / Rabbit / 1 in 300 / Synaptic systems
160003
Pax6 / Rabbit/ 1 in 500 / Covance
PRB-278P
acTub / Mouse/ 1 in 1000 / AbCam
ab24610
Denisin-180 / Rabbit/ 1 in 1000 / Synaptic Systems 189 002
Cortactin / Rabbit/ 1 in 1000 / Cortactin(H222) Antibody #3503
Cofilin / Rabbit/ 1 in 500 / Cofilin (D3F9) XP® Rabbit mAb #5175
GAPDH / Mouse/ 1 in 10,000 / Protein tech 60004-1-Ig
LHX6 / Mouse/ 1 in 100 / LHX6 Antibody (A-9): sc-271433
Phospho-cofilin / Rabbit/ 1 in 500 / Phospho-Cofilin (Ser3) (77G2) Rabbit mAb #3313
TTF1 / Rabbit/ 1 in 500 / Santa Cruz
sc-13040
Table S3: Percentage of Tuj1 positive cells at day 30 of neuralisation.Mean was calculated from three biological replicates.
Cell Lines / Mean Tuj1 positive percentage / SDControl P1 C2 / 80.49839095 / 0.013463212
Control P2 C1 / 84.46022284 / 0.033970585
Control P3 / 84.04020266 / 0.139174056
Shank3 P1 C1 / 85.25254575 / 0.057355947
Shank3 P1 C2 / 87.70438767 / 0.074158643
Supplementary Methods:
Cortical Differentiation:Briefly, with iPSCscells at 100% confluency, the medium was changed to N2/B27 and SMAD inhibitors were added (SB431542-10μM, Dorsomorphin 1μM). The N2 media contained DMEM, N2 supplement glutamax, 5ug/ml insulin, NEAA and 100uM 20mercaptoethanol while the B27 media contained neurobasal media, B27 supplement and glutamax. They were added in the ratio of 1:1. Thereafter, the medium was supplemented with SMAD inhibitors and changed every day for 7 days. On day 8, the cells were split 1:1 onto geltrex substrate, giving rise to a sheet of neural progenitor cells. The cells were then fed alternate days with N2/B27 and once confluent they were split. On day 20, the cells were transfered to polyD-lysine and laminin (10μg/ml), DAPT 10μM and B27 media to differentiate into neurons. Immature neurons emerged around day 26.
Immunocytochemistry Cells were fixed with 4% PFA, washed (3x) with PBS, permeabilized with 0.1% triton-X (15 mins room temperature) and blocked using 5% donkey serum (1 hour room temperature). Primary antibodies were diluted in 1% donkey serum and applied (overnight at 4°C). The following primary antibodies were used as described in supplementary table 3. Secondary antibodies were diluted (1:500) in 1% donkey serum and applied for 1 hour at room temperature. The following secondary antibodies were used: Alexa 488, 594, and 647 (Invitrogen). Neurons were visualized using either Olympus fluorescence microscope or a laser scanning confocal microscope equipped with 405/488/594/633 lasers (Leica system). Images within an experiment were acquired with identical acquisition setting at 40x, 63x and 100x.
Synaptic Puncta Measurement
Images were taken from the 63x objective on a Leica TCS SP8 Confocal Laser Scanning Microscope coupled with LAS AF lite software. We used 386, 488 and 594 nm lasers, along with the appropriate excitation and emission filters. These settings were kept consistent while taking images from all cultures. Acquired images were converted into 8-bit tiff files and analyzed with Image J software version 7.3. At least two portions of neurites, length not exceeding 50m were selected. This region was added to ROI (region of interest) manager. Following this, the images were thresholded such that the synaptic puncta would turn black and the background would turn white. The thresholded images were then analyzed through “Analyze Particles”. The size limit at this point was set up to 0.03-3 µm2. This meant that only punctas with a size of 0.03 to 3 µm2would be measured. The summary from “Analyze particles” gave the total number of punctas observed in the region of interest. These steps were repeated until the whole neuron was captured. The data obtained was analyzed as the number of punctas/50µm.
hESC culture: The hESC line SA001 (NIH Registration Number 0085; Cellectis, Sweden) was cultured on hESC-qualified Matrigel (BD Biosciences) in mTESR1 (STEMCELL Technologies) with daily medium changes. When confluent, colonies were dissociated to single cells using Accutase (LifeTechnologies) and subcultured at a ratio of 1:10 – 1:20 in the presence of 10 µM ROCK Inhibitor Y-27632.
GFP transfection and tracing of iPSC derived neurons
iPSC derived neuronal culture were transfected with eGFP at two stages; 10 days from terminal plating (day 30 immature neurons) and 25 days from terminal plating (day 45 young neurons). The transfection was done using Lipofectamine 2000 and the neurons were assayed 48 hours after transfection. The cells were fixed using 4% paraformaldehyde, immunolabeled with anti GFP marker and visualized using Alexa 488. Images were taken using inverted fluorescent microscope (Olympus) at 10x and tracing was performed using NeuronJ software version 7.3.
Astroglial Co-Culture for Electrophysiology
hIPSC derived neurons were maintained in long term cell culture for electrophysiology by co-culture with primary rat astroglia. hIPSC derived neurons (d23 post neuralisation) were terminally plated on plastic cell culture dishes (Ibidi, Germany) coated with poly-D-lysine and laminin at a density of 30-60k/cm2. Neurons were maintained in Neurobasal media supplemented with glutamax, B27, penicillin/streptomycin and Ascorbic Acid. For the first 7 days after terminal plating, DAPT was included in the media.
Rat astroglia were cultured as previously described (Kaech and Banker, Nature Protocols 2006). Briefly, E18 rat cortices were dissociated with trypsin and expanded for at least 2 weeks in MEM media supplemented with glucose (0.6%), horse serum (10%) and penicillin-streptomycin. Contaminating cells in the culture were removed by mechanical agitation. Astroglia were harvested with trypsin and plated on Poly-D-Lysine coated coverslips and maintained in isolated culture for a further week, before being suspended above the hIPSC derived neurons (d30 post neuralisation).
Electrophysiology Methods
Whole-cell patch clamp recordings were obtained from hIPSC derived neurons (d60-d70 post neuralisation). Patch pipettes (5-7.5 MΩ) were pulled from borosilicate glass capillary tubes using a P97 Flaming/Brown Micropipette Puller (Sutter Instruments). The internal patch solution contained (in mM): 135 KGluconate, 10 KCl, 1 MgCl2, 10 HEPES, 2 Na2-ATP and 0.4 Na3-GTP. All recordings were conducted at room temperature. The external recording solution contained (in mM): 139 NaCl, 2.5 KCl, 10 HEPES, 10 Glucose, 2 CaCl2, 1.3 MgCl2.
Whole-cell voltage clamp recordings were conducted at a holding potential of -70mV in order to monitor predominantly AMPA mediated spontaneous excitatory post synaptic currents (EPSCs). Inhibitory post synaptic currents (IPSCs) were isolated by voltage clamp recording at 0mV. In order to monitor the activation of fast voltage dependent currents, depolarising test potentials were applied between -60 mV and +20 mV from a holding potential on -70 mV. Current clamp recordings were conducted in order to monitor action potential firing during 500 ms-long current injections from a holding potential of -60 mV.
A stable access resistance was maintained between 20-35 MΩ for the duration of recording. Data was generated and acquired using an EPC10 amplifier (Heka Instruments) and the software PatchMaster. Voltage clamp data was sampled at 15 kHz and filtered at 3 kHz. Current clamp recordings were sampled at 10 kHz.
Gene expression
iPSCs were differentiated into hypothalamic and cortical neurons using the protocols mentioned above. RNA was extracted using RNA mini easy kit and cDNA was synthesized using the Superscript kit III. The qPCR was performed for the following genes Nkx 2.1, GnRH1, TRH and Tbr1. The primer sequences for these are as follows-