SUPPLEMENTARY MATERIAL
Expanded Methods
Experimental model of myocardial infarction (MI).
Male Sprague-Dawley rats were housed in a pathogen-free facility under strict veterinary supervision and maintained in controlled rooms with a 12 hours light/dark cycle. The animals received a commercial rat diet and water ad libitum. Before surgical procedures, animals were anesthesized with ketamine (75 mg/kg, intraperitoneal) and medetomidine (0.5 mg/kg, intraperitoneal). Then, they were intubated and ventilated with a 16 gauge intravenous catheter and placed in supine position over a temperature control pad. The animals were monitored by electrocardiogram (ECG) electrodes connected to the limbs through small needles inserted subcutaneously. Left-sided thoracotomy was performed by a small incision between the third and fourth intercostal spaces. The incision was expanded by a blunt ended retractor in such a manner that the lungs wereavoided in the area of retraction. The pericardial sac surrounding the heart was cut open; the heart was not exteriorized. The ligation of the left anterior descending coronary artery (LAD) was carried out 8 mm from the origin. Using a tapered atraumatic needle, a 6-0 silk ligature was passed underneath the LAD and tied with three knots. Visible blanching and cyanosis of the anterior wall of the left ventricle and swelling of the left atrium were indicative of successful ligation. The procedure was considered successful if the ECG showed ST-segment elevation and the anterior wall of the left ventricle became blanched. Ribs and muscles were closed using 6-0 vicryl dissolvable sutures leaving a small gap to aspirate the air left in the chest cavity. The air was aspirated by an in-house tube (2 mm diameter), in a manner that the lungs were not touched. At the time of closure, neomycin powder and betadine were applied to the muscle and skin stitch sites, respectively. The surgical site was dressed daily to avoid any infection and to monitor for any dehiscence of the suture site. The entire procedure was performed within 20 min after induction of anesthesia. Sham operated rats underwent the same procedure without any ligation. After surgery, animals received four doses of buprenorphine (0.05 mg/kg, subcutaneous) at 8 hour intervals.
Alzet® Mini-Osmotic pump: priming procedure and implantation.
Mini-Osmotic pumps (Model 1003D) (100 μl), providing a continuous infusion at a rate of 1 μl/h for 72 hours, and catheters (0007710), both from Alza Corporation, Palo Alto, CA, USA, were filled with different dilutions of either RLX or placebo, as described by the manufacturer. The pump-catheter systems were then placed in a 50 ml tube filled with sterile 0.9% saline buffer and incubated at 37°C overnight prior to implantation to allow priming. The pump-catheter system was placed in a dorsal subcutaneous skin pocket. The pump-cannula was tunneled subcutaneously and was inserted into the jugular vein.
Echocardiography.
A transthoracic echocardiographic examination (4-12 MHz phased array sectorial transducer, HD7 XE Philips) was performed in a blinded fashion at 7 days after LAD ligation, before sacrifice. The measurements were obtained according to the recommendations of the Echocardiography Committee of the Specialty of Cardiology of the AmericanCollege of Veterinary Internal Medicine. The arithmetic mean of three measurements was used. Left ventricular volumes and ejection fraction (LVEF) were calculated from the four chambers long axis view by the Simpson’s method.
RNA extraction and quantitative real-time PCR.
For the isolation of ribonucleic acid (RNA), 50 mg of myocardium from infarcted or border area was washed with cold phosphate buffered saline gefore following the manufacturer’s instructions for the Dynabeads mRNA Direct kit (Amersham Pharmacia Biotech, Piscataway, NJ, USA). First–strand complementary deoxyribonucleic acid was synthesized with the GeneAmp RNA Polymerase Chain Reaction (RT-PCR) kit (Roche, Branchburg,NJ, USA), as per the manufacturer´s instructions. Real time RT-PCR was performed with SYBR Premix Ex Taq (Takara Biothecnology, Dalian, China) following the manufacturer´s instructions in a LightCycler system (Roche). The primer sequences used for each gene are described in Table S1. Glyceraldehyde 3-phosphate dehydrogenase (GADPH) was used as housekeeping gene. Efficiency for each primer pair was assessed by using serial dilutions of cDNA. Subsequently, 0.5-3 μl of template cDNA was amplified by 50 cycles of PCR (10 s at 95 ºC, 10 s at 60 ºC and 15 s at 72 ºC), followed by a dissociation stage to ensure that only one product was amplified.
Immunohistochemistry
Macrophage infiltration and blood vessel density were assessed by immunohistochemical examination using antibodies against CD-68 and CD-31, respectively. Formalin-fixed and paraffin wax-embedded cardiac tissues from the LV transverse sections were sectioned (3 μm) and placed on poly-L-lysine-coated glass slides. The sections were deparaffinized and pre-treated in Dako PT Link for 20 min to 97ºC using EnVision FLEX Target Retrieval Solution, High pH (Dako, Denmark). For CD-68 staining, rehydrated sections were incubated overnight with a monoclonal antibody to CD-68 (working dilution 1:200, Abcam, Cambridge, MA, USA). After primary antibody incubation, sections were incubated with biotinylated rabbit anti-rat immunoglobulin G (Vector Laboratories, Burlingame, CA, USA), followed by streptavidin-biotin complex (Dako, Denmark) and development with diaminobenzidine. Immunohistochemical CD-31 staining was made with a ready-to-usemonoclonal antibody (1:100, clone JC70A, Dako), where the sections were incubated for 20 min with primary antibody and developedwith diaminobenzidine at room temperature with EnVision™ FLEX+ (Dako) following the manufacturer’s instructions. High resolution images were obtained through a Leica SN400F slide scanner (Leica Microsystems, Gateshead, United Kingdom). CD-68 or CD-31 staining was quantified by averaging results for seven to ten representative high-powered fields (x40) in infarcted myocardium using the Tissue Image Analysis package (Slidepath, Leica Microsystems). CD-68 expression was expressed as the CD-68–stained area/total myocardium area ratio and referred to the sham group. Blood vessel density was calculated as the average of number of CD-31 stained blood vessels per field.
Interstitial fibrosis
Agreement between observers was assessed by means of Bland-Altman plots and intraclass correlation coefficient (ICC) using the two-way mixed model for average measurements. Interobserver variability was excellent, with an ICC of 0.949 (95% CI: 0.918–0.968). There was a mean difference of 0.212 units for the collagen fraction area between observers and a level of agreement ranging between -1.472 and 1.897 units at a 95% confidence interval, with three (4.17%) cases over and two cases (2.78%) below the limits. Bland-Altman plot is shown in Figure S1.
Table S1. Primers used for quantitative RT-PCR analysis
Rat mRNA / Forward primer (5´→3´) / Reverse primer (5´→3´)α-SMA / GTCCCAGACATCAGGGAGTAA / TCGGATACTTCAGCGTCAGGA
Collagen I / CATGTTCAGCTTTGTGGACCT / GCAGCTGACTTCAGGGATGT
Collagen III / TCCCCTGGAATCTGTGAATC / TGAGTCGAATTGGGGAGAAT
Galectin-3 / CCCGACTGGACCACTGACA / CAGCATGCGAGGCATGACT
GAPDH / CTGCACCACCAACTGCTTA / AGAGGGGCCATCCACAGTC
IL-6 / CCACTTCACAAGTCGGAGGCTTA / GTGCATCATCGCTGTTCATACAATC
MCP-1 / TTCCTTATTGGGGTCAGCAC / CAGTTAATGCCCCACTCACC
MMP2 / GATGGCAAGGTGTGGTGTG / AATCGGAAGTTCTTGGTGTAGG
MMP9 / AAGCCTTGGTGTGGCACGAC / TGGAAATACGCAGGGTTTGC
MMP10 / ACCCCACTCACATTCTCCAG / CATCGAAGTGAGCATCTCCA
MMP13 / TCTGCACCCTCAGCAGGTTG / CATGAGGTCTCGGGATGGATG
sST2 / GGTGTGACCGACAAGGACT / TTGTGAGAGACACTCCTTAC
TGF-β / CACCCGCGTGCTAATGGT / GGCACTGCTTCCCGAATG
TNF-α / ATACACTGGCCCGAGGCAAC / CCACATCTCGGATCATGCTTTC
VEGFA / CAAGCCAAGGCGGTGAGCCA / TCTGCCGGAGTCTCGCCCTC
VEGFB / AACAGAAGAAAGTGGTGTCATG / TGAGGATCTGCATTCGGACTTG
α-SMA, alpha smooth muscle Actin; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IL-6, interleukin 6; MCP-1, monocyte chemoattractant protein-1; MMP, matrix metalloproteinase; sST2, soluble suppression of tumorigenecity-2; TGF-β, transforming growth factor beta; TNF-α, tumor necrosis factor alpha; VEGF, vascular endothelial growth factor.
Figure S1