ESM Table S1. List of forward and reverse primers for mitochondrial and nuclear DNA markers used during screening. Only the Cytochrome-c Oxidase subunit-I and S7 markers were used for analyses. Amplification was considered unsuccessful where PCR resulted in amplification of < 50% of the samples as visualized on a 1.5 % agarose gel.

Mitochondrial gene / Reference / Forward primer / Reverse primer / Outcome
12S / Palumbi (1996) / 12Sa
AAACTGGGATTATAGACCCCACTAT / 12Sb
GAGGGTGACGGGCGGTCTCT / Amplification unsuccessful
16S / Palumbi (1996) / 16Sar-L
GCCTGTTTATCAAAAACAT / 16Sbr-H
CCGGTCTGAACTCAGATCAGT / Amplified with no fixed differences
Cytochrome Oxidase 1 (COI) / Ward et al. (2005) / F2
CGACTAATC ATAAAGATATCGGCAC / R2
ACTTCAGGGTGACCGAAGAATCAGAA / Amplified with no fixed differences
Control Region (CR) / Lee et al. (1995) / CRA
TTCCACCTCTAACTCCCAAAGCTAG / CRE
ACGCTGGAAAGAACGCCCGGCATGG / Amplified with no fixed differences
Cytochrome B (CYT-B) / HS: Song et al. (1998)
LS: Taberlet et al. (1992) / HS GTGACTTGAAAAACCACCGTTG / LS
AATAGGAAGTATCATTCGGGTTTGATG / Amplification unsuccessful
Nuclear gene / Reference / Forward primer / Reverse primer / Outcome
36298E1 / Li et al. (2010) / 36298E1-F
GATCCTGAGGGAYTCCCAYGGTGT / 36298E1-R
GGCCAGGACTCTCYTGGTCTTGTAGT / Amplified with no fixed differences
ETS2 / Dolman and Phillips (2004) / ETS2F
AGCTGTGGCAGTTTCTTCTG / ETS2R
CGGCTCAGCTTCTCGTAG / Amplified with no fixed differences
TMO 4C4 / Streelman and Karl (1997) / TMO-F1
CCTCCGGCCTTCCTAAAACCTCTC / TMO-R1
CATCGTGCTCCTGGGTGACAAAGT / Amplified with no fixed differences
Histone 3 (H3) / Colgan et al. (1998) / H3A-L
ATGGCTCGTACCAAGCAGACVGC / H3B
ATATCCTTRGGCATRATRGTGAC / Amplification unsuccessful
S7 / Chow and Hazama (1998) / S7RPEX1F
TGGCCTCTTCCTTGGCCGTC / S7RPEX2R
AACTCGTCTGGCTTTTCGCC / Amplified with no fixed differences
Recombination Activating Gene 2
(RAG2) / Westneat and Alfaro (2005) / F1
GAGGGCCATCTCCTTCTCCAA / R3
GATGGCCTTCCCTCTGTGGGTAC / Amplification unsuccessful
Recombination Activating Gene 2
(RAG2 – Modified) / DiBattista et al. (2012) / RAG2 2F
SACCTTGTGCTGCAAAGAGA / RAG2 2R
GGATCCCCTTBTCATCCAGA / Amplification unsuccessful

References

Chan TTC, Sadovy Y (2002) Reproductive biology, age and growth in the chocolate hind, Cephalopholis boenak (Bloch, 1790), in Hong Kong. Mar Freshw Res 53:791–803

Chow S, Hazama K (1998) Universal PCR primers for S7 ribosomal protein gene introns in fish. Mol Ecol 7:1247–1263

Colgan DJ, McLauchlan A, Wilson GDF, Livingson SP, Edgecombe GD, Macaranas J, Cassis G, Gray MR (1998) Histone H3 and U2 snRNA DNA sequences and arthropod molecular evolution. Aust J Zool 46:419–437

de Araujo JN, Martins AS (2006) Age and growth of coney (Cephalopholis fulva), from the central coast of Brazil. J Mar Biol Assoc UK 1:187– 191

DiBattista JD, Waldrop E, Bowen BW, Schultz JK, Gaither MR, Pyle RL, Rocha LA (2012) Twisted sister species of pigmy angelfishes: discordance between taxonomy, colouration, and phylogenetics. Coral Reefs 31:839–851

Dolman G, Phillips B (2004) Single copy nuclear DNA markers characterized for comparative phylogeography in Australian wet tropics rainforest skinks. Mol Ecol 4:185–187

Lee WJ, Howell WH, Kocher TD (1995) Structure and evolution of teleost mitochondrial control regions. J Mol Evol 41:54–66

Li C, Riethovan JM, Ma L (2010) Exon-primed intron-crossing (EPIC) markers for non-model teleosts fishes. BMC Evol Biol 10:90–102

Palumbi S (1996) Nucleic acids II: The polymerase chain reaction. Mol Syst 10:205–248

Song CB, Near TJ, Page LM (1998) Phylogenetic relations among percid fishes as inferred from mitochondrial cytochrome b DNA sequence data. Mol Phylogenet Evol 10:343–353

Streelman JT, Karl SA (1997) Reconstructing labroid evolution with single-copy nuclear DNA. Proc R Soc Lond Biol Sci 264:1011–1020

Taberlet P, Meyer A, Bouvert J (1992) Unusually large mitochondrial variation in populations of the blue tit, Parus caeruleus. Mol Ecol 1:27–36

Ward RD, Zemlak TS, Innes BH, Last PR, Hebert PD (2005) DNA barcoding Australia’s fish species. Philos Trans R Soc Lond B Biol Sci 360:1847–1857

Westneat MW, Alfaro MA (2005) Phylogenetic relationships and evolutionary history of the reef fish family Labridae. Mol Phylogenet Evol 36:370–390

ESM Table S2. Descriptions of micro-habitat categories used to classify substrates along point intercept transects at Christmas Island. Descriptions based on Eagle et al. (2001) and Hobbs et al. (2010).

Micro-habitat / Description
Calcareous algae / Hard, substrate encrusting coral that is often pink in colour
Branching corals / Arborescent, columnar and digitate scleractinian corals
Massive corals / Spherical, hemispherical and mount shape scleractinian corals
Tabular corals / Laminar or Plating scleractinian corals
Foliaceous corals / Thin leafy scleractinian corals that form irregular shapes and whirls
Corymbose corals / Bushy shaped scleractinian coral with branches extending from a single stem
Encrusting corals / Scleractinian corals that grow as a thin veneer on the substrate
Sand / Calcareous or silicious grains
Bare rubble / Segments of dead coral that are not yet covered in live algae or other live corals
Soft corals / Alcyonarian corals that lack a hard calcium carbonate skeleton
Turf algae / Epilithic algae that grows on the surface of rocky substrates and dead coral

References

Eagle JV, Jones GP, McCormick MI (2001) A multi-scale study of the relationships between habitat use and the distribution and abundance patterns of three coral reef angelfishes (Pomacanthidae). Mar Ecol Prog Ser 214:253–265

Hobbs JPA, Jones GP, Munday PL (2010) Rarity and extinction risk in coral reef angelfishes on isolated islands: interrelationships among abundance, geographic range size and specialization. Coral Reefs 29:1–11

ESM Table S3. Resemblance matrix of percent (%) cover of benthic micro-habitat variables based on point intercept transects conducted at Christmas and Cocos-Keeling Islands. * indicates correlations between benthic micro-habitat variables which were >70%.

Branching corals / Tabular corals / Corymbose / Massive corals / Foliaceous corals / Encrusting / Calcareous algae / Turf algae / Sand / Bare rubble / Soft corals
Branching corals / - / - / - / - / - / - / - / - / - / - / -
Tabular corals / -0.29549 / - / - / - / - / - / - / - / - / - / -
Corymbose corals / -0.19706 / 0.208336 / - / - / - / - / - / - / - / - / -
Massive corals / -0.17782 / 0.533066 / 0.466315 / - / - / - / - / - / - / - / -
Foliaceous corals / -0.16768 / 0.382442 / 0.215824 / 0.310723 / - / - / - / - / - / - / -
Encrusting corals / 0.190019 / 0.079912 / 0.372868 / 0.540375 / 0.036816 / - / - / - / - / - / -
Calcareous algae / 0.055206 / 0.146366 / 0.494969 / 0.420176 / 0.067611 / 0.369987 / - / - / - / - / -
Turf algae / -0.28058 / -0.40195 / -0.47524 / -0.75361 * / -0.42714 / -0.75616 * / -0.5244 / - / - / - / -
Sand / -0.05119 / 0.108055 / -0.24378 / -0.12203 / -0.06534 / -0.06267 / -0.17397 / -0.06478 / - / - / -
Bare rubble / 0.38191 / -0.04915 / -0.10103 / 0.072596 / 0.397527 / 0.113938 / -0.30551 / -0.34408 / 0.175139 / - / -
Soft corals / 0.259526 / -0.1667 / 0.182873 / -0.16511 / -0.25485 / 0.002548 / 0.155288 / 0.029517 / -0.26879 / -0.11019 / -