Electronic Supplementary Material for Microchimica Acta
Aptamer-based fluorometric determination of ATP by using target-cycling strand displacement amplification and copper nanoclusters
Yu-Min Wang,1 Jin-Wen Liu,1 Lu-Ying Duan,1 Si-Jia Liu*,2 and Jian-Hui Jiang*,1
1 State Key Laboratory of Chemo/Biosensing and Chemometrics, College of Chemistry and Chemical Engineering, Hunan University, Changsha, Hunan 410082, P. R. China.
2 Guangxi Collaborative Innovation Center for Biomedicine and Guangxi Key Laboratory of Regenerative Medicine, School of Preclinical Medicine, Guangxi Medical University, Nanning, Guangxi 530021, P. R. China.
Table S1. Sequences of DNA probes used in this worka
AP / CCTGGGGGAGTATTGCGGAGCAAGGTTTTTTTACCTTGCT
Primer 1 / AGCAAG
Primer 2 / AGCAAGG
Primer 3 / AGCAAGGT
Primer 4 / AGCAAGGTA
AP’ / AGCAAGGTAAAAAAACCTTGCTCCGCAATACTCCCCCAGGT
a Italic type sequences in AP probe indicate aptamer sequence of adenosine 5′-triphosphate (ATP). Underlined sequences indicate complementary regions of the probes to form hairpin structure.
Table S2. An overview on nanomaterial-based methods for ATP assay.
CdTd QDs / Electrochemiluminescence / 7.6 nM / S1
Gold NP / Colorimetry / 50 nM / S2
Gold NP / Colorimetry / 1.0 nM / S3
Gold NP / Resonance light scattering / 4.5 nM / S4
Gold NP / Raman / 20 pM / S5
MnO2 nanosheets / Electrochemistry / 0.32 nM / S6
DNA nanoassembly / Electrochemistry / 5.8 nM / S7
Carbon nanoparticles / Fluorescence / 0.2 nM / S8
Magnetic nanoparticles / Fluorescence / 10 nM / S9
Silver nanoclusters / Fluorescence / 81 pM / S10
Copper nanoclusters / Fluorescence / 93 nM / S11
Copper nanoclusters / Fluorescence / 5 pM / This work
References:
[S1] Liu Y, Lei J, Huang Y, Ju H (2014) “Off-On” Electrochemiluminescence System for Sensitive Detection of ATP via Target-Induced Structure Switching. Anal Chem 2014 86:8735-8741.
[S2] Huo Y, Qi L, Lv XJ, Lai T, Zhang J, Zhang ZQ (2016) A sensitive aptasensor for colorimetric detection of adenosine triphosphate based on the protective effect of ATP-aptamer complexes on unmodified gold nanoparticles. Biosens Bioelectron 78:315-320.
[S3] Gao Z, Qiu Z, Lu M, Shu J, Tang D (2017) Hybridization chain reaction-based colorimetric aptasensor of adenosine 5′-triphosphate on unmodified gold nanoparticles and two label-free hairpin probes Biosens Bioelectron 89:1006-1012.
[S4] Y He, L Liao, C Xu, R Wu, S Li, Yang Y (2015) Determination of ATP by resonance light scattering using a binuclear uranyl complex and aptamer modified gold nanoparticles as optical probes. Microchim Acta 182:419-426.
[S5] Wu Y, Xiao F, Wu Z, Yu R (2017) Novel Aptasensor Platform Based on Ratiometric Surface-Enhanced Raman Spectroscopy. Anal Chem 89:2852-2858.
[S6] Tang D, Hou L (2016) Aptasensor for ATP based on analyte-induced dissociation of ferrocene-aptamer conjugates from manganese dioxide nanosheets on a screen-printed carbon electrode. Microchim Acta 183:2705-2711.
[S7] Ding X, Wang Y, Cheng W, Mo F, Sang Y, Xu L, Ding S (2017) Aptamer based electrochemical adenosine triphosphate assay based on a target-induced dendritic DNA nanoassembly. Microchim Acta 184:431-438.
[S8] Lin X, Cui L, Huang Y, Lin Y, Xie Y, Zhu Z, Yin B, Chen X, Yang CJ (2014) Carbon nanoparticle-protected aptamers for highly sensitive and selective detection of biomolecules based on nuclease-assisted target recycling signal amplification. Chem Commun 50:7646-7648.
[S9] Guo Y, liu J, Yang G, Sun X, Chen HY, Xu JJ (2015) Multiple turnovers of DNAzyme for amplified detection of ATP and reduced thiol in cell homogenates. Chem Commun 51:862-865.
[S10] Chen J, Ji X, Tinnefeld P, He Z (2016) Multifunctional Dumbbell-Shaped DNA-Templated Selective Formation of Fluorescent Silver Nanoclusters or Copper Nanoparticles for Sensitive Detection of Biomolecules. ACS Appl Mater Interfaces 8:1786-1794.
[S11] Song Q, Wang R, Sun F, Chen H, Wang Z, Na N, Ouyang J (2017) A nuclease-assisted label-free aptasensor for fluorescence turn-on detection of ATP based on the in situ formation of copper nanoparticles. Biosens Bioelectron 87:760-763.
Fig. S1 Fluorescence spectra of CuNCs which have been synthesized using 5 µL 20 µM hairpin AP probe, 5 µL 20 µM hairpin AP’ probe or dsDNA (5 µL 20 µM AP’ probe hybridization with 5 µL 20 µM AP’ probe) as template, respectively. Data were collected on a FluoroMax-4 spectrofluorometer from 540 to 640 nm with an interval of 1 nm under excitation at 340 nm. The slits were set at 10 nm for both exciation and emission, and the PMT voltage was set to 950 V. The scan rate was 10 nm.s-1.
Fig. S2 (A) The effect of reduction time on the CuNCs formation. The concentrations of dsDNA templates (AP/AP’), Cu2+ and sodium ascorbate were 1 μM, 100 μM and 1 mM, respectively. (B) The effect of Cu2+ concentration on the fluorescence intensity of CuNCs. The concentrations of dsDNA templates (AP/AP’) and sodium ascorbate were 1 μM and 1 mM. The fluorescence intensity at 598 nm with excitation at 340 nm was used to evaluate these effects.
Fig. S3 Fluorescence signaling profile of TCSDA-CuNCs method using different primers (5 µL 40 µM) with varying length in region number from 6 to 9 with (red line) and without (black line) ATP (2 µL 1.0 nM). The fluorescence intensity at 598 nm with excitation at 340 nm was used to evaluate these effects.
Fig. S4 The optimization of primer using agarose gel electrophoresis. Lane M is the DNA size marker. Lane 1, lane 3, lane 5 and lane 7 are AP; 1 nM target plus primer 1, primer 2, primer 3 and primer 4, respectively. Lane 2, Lane 4, Lane 6 and Lane 8 are AP without target plus primer 1, primer 2, primer 3 and primer 4, respectively. Lane 9 is AP; Lanes 10-13 are primer 1, primer 2, primer 3 and primer 4, respectively.
Fig. S5 Typical fluorescence spectra of obtained CuNCs for ATP detection. (a) AP, primer, dNTPs and Klenow polymerase (black line), (b) ATP, primer, dNTPs and Klenow polymerase (green line), (c) ATP, AP, dNTPs and Klenow polymerase (blue line), (d) ATP, AP, primer and Klenow polymerase (cyan line), (e) ATP, AP, primer and dNTPs (pink line), (f) ATP, AP, primer, dNTPs and Klenow polymerase (red line). Data were collected from 540 nm to 640 nm with excitation at 340 nm.