Effect of Akt Inhibition on Scatter Factor Regulated Gene Expression
SUPPLEMENTARY DATA
SUPPLEMENTAL TABLES
Table S1. Genes induced by SF in the absence and presence of dominant negative (DN) Akt @ T=6 hr.
DU-145 cells T=6 hr (2/1, 4/3) {[pcDNA3+SF]/pcDNA3, [DN-Akt+SF]/DN-Akt}Gene Name / Symbol / GeneBank Acession No. / Log Signal Ratio
Mean SEM (N)
[pcDNA3+SF]/
pcDNA3 / [DN-Akt+SF]/
DN-Akt
Transcription Factors / Nuclear Proteins
v-Jun avian sarcoma virus 17 oncogene homolog / JUN / NM_002228.2 / 1.2 ± 0.1 (3) / 0.7 ± 0.3 (2)
Liver-specific bHLH-Zip transcription factor / LISCH7 / NM_015925.1 / 0.8 ± 0.0 (2) / 0.8 (1)
Stress Response / Mitochondrial Proteins
Spermidine/spermine N1-acetyltransferase / SAT / NM_002970.1 / 0.8 ± 0.1 (3) / 0.6 ± 0.1 (2)
DNA Replication / Cell Cycle Progression
Uridine phosphorylase / UP / NM_003364.1 / 0.9 ± 0.1 (3) / 1.0 ± 0.1 (3)
Excision repair cross-complementing repair def. 1, transcript variant 2 / ERCC1 / NM_001983.1 / 0.6 ± 0.1 (2) / 0.9 ± 0.0 (3)
Signal Transduction
Paxillin beta / PAXB / D86862.1 / 0.6 ± 0.1 (3) / 0.8 ± 0.1 (2)
SMAD specific E3 ubiquitin protein ligase 2 / SMURF2 / AY014180.1 / 0.9 ± 0.1 (2) / 0.5 ± 0.0 (2)
Ligands and Receptors
Peroxisome proliferator-activated receptor gamma / PPARG / NM_016109.1 / 1.9 ± 0.2 (3) / 2.1 ± 0.2 (3)
Diphtheria toxin receptor (heparin-binding EGF-like growth factor) / DTR / NM_001945.1 / 1.8 ± 0.8 (2) / 1.0 (1)
Urokinase-type plasminogen activator receptor / UPAR / U08839.1 / 1.0 ± 0.1 (3) / 0.6 ± 0.1 (2)
Metabolism
6-Phosphofructo-2-kinasefructose-2,6-biphosphatase 3 / PFKFB3 / NM_004566.1 / 0.9 ± 0.1 (3) / 0.9 ± 0.1 (2)
Lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) / LSS / D63807.1 / -0.8 ± 0.1 (2) / -0.6 ± 0.2 (2)
Cytoskeleton / Cell Adhesion / Extracellular Matrix
Dynamin binding protein (also called KIAA1010, TUBA) / DNMBP / AB023227.1 / 0.5 ± 0.0 (3) / 0.9 (1)
Immune Response / Inflammation / Interferon-Responsive
Interleukin-6 signal transducer (Gp130 of rheumatoid arthritis) / IL6ST / AB015706.1 / 0.8 (1) / 0.7 ± 0.2 (2)
Similar to CD44 antigen, clone MGC:10468 / CD44 / BC004372.1 / 0.5 (1) / 0.8 ± 0.1 (3)
CD44 antigen (homing function and Indian blood group system) / CD44 / NM_000610.1 / 0.8 ± 0.2 (2) / 0.7 (1)
Differentiation / Development / Tissue-Restricted Expression
Neuron navigator 3 (KIAA0938, steerin 4, POMFIL1) / NAV3 / NM_014903.1 / 1.0 ± 0.2 (3) / 1.0 (1)
Development and differentiation enhancing factor 2 / DDEF2 / NM_003887.1 / 0.8 ± 0.3 (2) / 0.6 ± 0.1 (2)
Smoothelin (contractile protein of smooth muscle cells) / SMTN / NM_006932.1 / 1.0 (1) / 0.7 ± 0.1 (2)
Hippocalcin-like 1 (putative calcium-binding protein of brain) / HPCAL1 / NM_002149.1 / 0.6 ± 0.2 (2) / 0.9 ± 0.2 (2)
Cell Survival / Apoptosis
Pleckstrin homology-like domain, family A, member 2 (IPL) / PHLDA2 / AF001294.1 / 0.9 ± 0.2 (3) / 0.8 ± 0.2 (2)
Tumor necrosis factor receptor superfamily, member 10b / TNFRSF10B / AF016266.1 / 0.8 ± 0.2 (2) / 0.6 (1)
RNA & Protein Processing/Trafficking
Protease, serine, 26 [developmentally regulated proteinase] / PRSS22 / NM_022119.1 / 1.2 ± 0.2 (2) / 0.9 (1)
Urokinase-type plasminogen activator / PLAU / U08839.1 / 1.0 ± 0.2 (2) / 0.6 ± 0.1 (2)
Preprourokinase [urokinase-type plasminogen activator] / PLAU / K03226.1 / 0.8 ± 0.1 (3) / 0.9 ± 0.0 (3)
Plasminogen activator, urokinase / PLAU / NM_002658.1 / 0.8 ± 0.0 (3) / 0.8 ± 0.1 (2)
Unknown / Uncharacterized
Chromosome X open reading frame 6 [unknown function] / CXORF6 / NM_005491.1 / 1.0 ± 0.3 (3) / 1.1 (1)
Homo sapiens clone FLB0708 mRNA sequence / - / AF113008.1 / 0.9 ± 0.2 (2) / 0.8 (1)
Homo sapiens clone CDABP0131 mRNA sequence / CDABP0131 / AY007161.1 / 0.5 ± 0.0 (3) / 0.9 ± 0.0 (3)
Consensus includes gb:BE617588 /gi:9888526/IMAGE:3845643 / - / BE617588 / 0.5 ± 0.2 (2) / 0.8 ± 0.1 (2)
Table S2. Genes induced by SF in the absence but not presence of DN-Akt @ T=6 hr.
DU-145 cells T=6 hr (2/1, 4/3) {[pcDNA3+SF]/pcDNA3, [DN-Akt+SF]/DN-Akt}Gene Name / Symbol / GeneBank Acession No. / Log Signal Ratio
Mean SEM (N)
[pcDNA3+SF]/
pcDNA3 / [DN-Akt+SF]/
DN-Akt
Transcription Factors / Nuclear Proteins
bK447C4.1 (novel MAFF oncogene family, protein F) like protein / MAFF / AL021977 / 0.8 ± 0.2 (2) / -
Transcription factor 8 (represses interleukin 2 expression) / TCF8 / NM_030751.1 / 0.8 ± 0.1 (2) / -
Ligands and Receptors
Soluble urokinase plasminogen activator receptor / SUPAR / AY029180.1 / 1.0 ± 0.2 (3) / -
Epiregulin (EGF family, ligand for ERBB family receptors) / EREG / NM_001432.1 / 0.9 ± 0.2 (2) / -
Erbb2-interacting protein ERBIN (also called LOC55914) / ERBB2IP / NM_018695.1 / 0.7 ± 0.3 (2) / -0.8 (1)
Cytoskeleton / Cell Adhesion / Extracellular Matrix
Thrombospondin 1 / THBS1 / NM_003246.1 / 1.0 ± 0.1 (2) / -
Cysteine-rich, angiogenic inducer, 61 / CYR61 / NM_001554.1 / 0.9 ± 0.3 (2) / -
Membrane & Transmembrane Proteins / Pore / Channels
Solute carrier 9 (Na/H antiporter), isoform A1 [APNH, NHE1] / SLC9A1 / M81768.1 / 1.5 ± 0.7 (2) / -
Immune Response / Inflammation / Interferon-Responsive
Interferon-induced protein with tetratricopeptide repeats 1 / IFIT1 / NM_001548.1 / 1.9 ± 0.1 (3) / -1.1 ± 0.4 (2)
Interferon -inducible protein (IFI-6-16) variant 3 / G1P3 / NM_022873.1 / 1.2 ± 0.4 (2) / -0.6 (1)
Myxovirus (influenza) resistance 1. / MX1 / NM_002462.1 / 1.1 ± 0.1 (2) / -1.0 ± 0.1 (3)
Interferon-stimulated protein, 15 kDa / ISG15 / NM_005101.1 / 1.0 ± 0.1 (2) / -0.9 ± 0.1 (3)
2-5 Oligoadenylate synthetase 3 / OAS3 / NM_006187.1 / 0.8 ± 0.2 (2) / -0.6 ± 0.0 (3)
Interferon regulatory factor 7 transcript variant c / IRF7 / NM_004030.1 / 0.8 ± 0.2 (2) / -0.5 ± 0.1 (2)
Cell Survival / Apoptosis
Phospholipid scramblase 1 / PLSCR1 / NM_021105.1 / 0.8 ± 0.2 (2) / -0.7 (1)
RNA & Protein Processing/Trafficking
U6 snRNA-associated Sm-like protein / LSM5 / NM_012322.1 / 1.0 ± 0.1 (2) / -
Membrane-associated RING-CH (TEB4, SSM4, KIAA0597) / MARCH-V1 / NM_005885.1 / 0.8 ± 0.3 (2) / -0.6 (1)
Unknown / Uncharacterized
KIAA0669 gene product [function unknown] / KIAA0669 / NM_014779.1 / 0.8 ± 0.3 (2) / -
Hypothetical protein FLJ12687 [function unknown] / CXORF34 / NM_024917.1 / -0.9 ± 0.3 (2) / -
Table S3. Genes induced by SF in the absence and presence of DN-Akt @ T=48 hr.
DU-145 cells T=48 hr (4/3, 2/1 {[DN-Akt+SF]/DN-Akt], [pcDNA3+SF]/pcDNA3]}Gene Name / Symbol / GeneBank
Accession No. / Log Signal Ratio
Mean SEM (N)
(pcDNA3+SF)/
pcDNA3 / (DN-Akt+SF)/
DN-Akt
Transcription Factors / Nuclear Proteins
High mobility group AT-hook 1 (high mobility group protein-R) / HMGA1 / AF176039.1 / 0.6 0.2 (3) / 0.9 0.1 (2)
H2B histone family, member Q / H2BFQ / NM_003528.1 / -0.7 0.1 (2) / -0.9 0.0 (2)
Stress Response / Mitochondrial Proteins
Acid-inducible phosphoprotein (OA48-18) / OA48-18 / NM_006107.1 / -0.7 0.0 (2) / -0.5 0.1 (2)
DNA Replication / Cell Cycle Progression
Excision repair cross-complementing rodent repair deficiency, group 1 / ERCC1 / NM_001983.1 / 0.8 0.1 (3) / 0.7 0.0 (3)
Uridine phosphorylase / UP / NM_003364.1 / 0.7 0.2 (3) / 0.8 0.1 (2)
MAD2 (mitotic arrest deficient, yeast, homolog)-like 1 / MAD2L1 / NM_002358.2 / -0.6 0.1 (2) / -0.8 0.0 (2)
Centromere protein F, 350/400 kDa (mitosin) / CENPF / U30872.1 / -0.9 0.2 (2) / -0.8 0.2 (2)
Polo (Drosophia)-like kinase [implicated in mitotic progression] / PLK / NM_005030.1 / -0.7 0.3 (2) / -0.5 0.1 (2)
G-2 and S-phase expressed 1 / GTSE1 / NM_016426.1 / -0.8 0.3 (2) / -0.4 0.0 (2)
Signal Transduction
Inositol 1,4,5-trisphosphate 3-kinase A / ITPKA / NM_002220.1 / 1.2 0.1 (3) / 1.6 0.4 (3)
Protein phosphatase 1, regulatory (inhibitor) subunit 1A. / PPP1R1A / NM_006741.1 / 0.7 0.2 (2) / 1.1 0.4 (3)
Mitogen-activating protein kinase kinase kinase kinase 2 / MAP4K2 / NM_004579.1 / 0.5 0.0 (2) / 1.1 0.3 (3)
Pleckstrin homology-like domain, family A, member 1 / PHLDA1 / NM_007350.1 / 1.0 0.1 (3) / 1.2 0.3 (3)
PCTAIRE protein kinase 2 (cdc2/cdkx subfamily ser/thr kinase) / PCTK2 / NM_002595.1 / 1.0 0.1 (2) / 0.8 0.2 (3)
Hippocalcin-like 1 (neuron-specific calcium binding protein family) / HPCAL1 / NM_002149.1 / 0.9 0.1 (3) / 0.8 0.2 (3)
Inositol 1,4,5-triphosphate receptor, type 3 / ITPR3 / NM_002224.1 / 0.8 0.1 (2) / 0.7 0.1 (3)
G protein-coupled receptor kinase 5 / GPRK5 / NM_005308.1 / 0.8 0.1 (3) / 0.6 0.1 (3)
P59fyn(T)=OKT3-induced calcium influx regulator / FYN / S74774.1 / 0.8 0.2 (2) / 0.3 0.0 (2)
A kinase (PRKA) anchor protein (gravin) 12 / AKAP12 / AB003476.1 / 0.7 0.2 (3) / 0.8 0.2 (3)
Insulin-like growth factor binding protein 7 / IGFBP7 / NM_001553.1 / -1.0 0.4 (2) / -0.8 0.1 (3)
Protein phosphatase 1B2 / PPM1B2 / AJ271832.1 / -0.6 0.2 (2) / -1.0 0.1 (2)
RAB6 interacting, kinesin-like (rabkinesin 6) / RAB6KIFL / NM_005733.1 / -0.9 0.2 (2) / -0.6 0.0 (2)
Ligands and Receptors
Stanniocalcin 1 (stanniocalcin, STC) / STC1 / NM_003155.1 / 2.7 0.8 (3) / 2.2 0.5 (3)
Lymphotoxin beta (TNF superfamily, member 3), transcript variant 1 / LTB / NM_002341.1 / 1.0 0.2 (3) / 1.1 0.1 (3)
Small inducible cytokine subfamily A (Cys-Cys), member 20 / SCYA20 / NM_004591.1 / 0.8 0.2 (2) / 0.8 0.0 (2)
Hyaluronan receptor (RHAMM) / RHAMM / U29343.1 / -0.9 0.0 (2) / -0.7 0.2 (2)
Metabolism
Asparagine synthetase / ASNS / NM_001673.1 / 0.6 0.0 (2) / 1.2 0.1 (2)
Sialyltransferase 7D (also called ST6GALNAC4) / SIAT7D / NM_014403.1 / 0.9 0.1 (3) / 0.8 0.1 (3)
Arginase, type II (catalyzes hydrolysis of arginine to ornithine & urea) / ARG2 / U75667.1 / 0.9 0.2 (3) / 0.9 0.2 (2)
Endothelin converting enzyme 1 / ECE1 / NM_001397.1 / 0.9 0.1 (2) / 0.7 0.2 (2)
UDP-N-acteylglucosamine pyrophosphorylase 1 (AgX-1 antigen) / UAP1 / S73498.1 / 0.8 0.2 (2) / 0.7 0.4 (2)
Phosphoenolpyruvate carboxykinase 2 (mitochondrial) / PCK2 / NM_004563.1 / 0.6 0.0 (2) / 0.9 0.1 (2)
Cysteinyl-tRNA synthetase / CARS / NM_001751.1 / 0.5 0.1 (2) / 0.8 0.2 (2)
Heme oxygenase (decycling) 1 / HMOX1 / NM_002133.1 / 0.5 0.0 (3) / 0.6 0.1 (2)
Stearoyl-CoA desaturase 4 (hypothetical protein FLJ21032) / SCD4 / NM_024906.1 / -0.5 0.2 (2) / -1.2 0.0 (2)
Cytoskeleton / Cell Adhesion / Extracellular Matrix
Microtubule-actin crosslinking factor 1 / MACF1 / AK023406.1 / 0.3 0.0 (2) / 0.8 0.1 (2)
Secreted phosphoprotein 1 (osteopontin, bone sialoprotein 1) / SPP1 / M83248.1 / -0.8 0.5 (2) / -0.8 0.2 (2)
Membrane & Transmembrane Proteins / Pore / Channels
Solute carrier family 4, sodium bicarbonate cotransporter, member 5 / SLC4A5 / AF053755.1 / 1.2 0.1 (2) / 1.2 0.1 (2)
CUB domain-containing protein 1 (hypothetical protein FLJ22969) / CDCP1 / NM_022842.1 / 1.2 0.1 (3) / 1.2 0.0 (3)
FXYD domain-containing ion transport regulator 2, transcript variant a / FXYD2 / NM_001680.2 / -1.1 0.3 (2) / -1.0 0.2 (2)
Immune Response / Inflammation / Interferon-Responsive
Interferon stimulated gene (20 kDa) / ISG20 / NM_002201.2 / 1.8 0.4 (3) / 2.5 0.7 (3)
CDw44 antigen (homing function and Indian blood group system) / CD44 / M24915.1 / 1.3 0.1 (3) / 1.5 0.1 (3)
CD44 isoform RC / CD44 / AF098641.1 / 1.3 0.1 (3) / 1.4 0.2 (3)
CD44 antigen, transcript variant 1 / CD44 / NM_000610.1 / 0.9 0.1 (3) / 1.3 0.1 (3)
CD44 antigen, transcript variant 2 / CD44 / BC004372.1 / 1.3 0.2 (3) / 1.3 0.0 (3)
Differentiation / Development / Tissue-Restricted Expression
Heart protein with four and a half LIM domains (FHL1) / FHL1 / U29538.1 / 0.3 0.3 (2) / 0.9 0.2 (3)
Four and a half LIM domains 1 protein isoform B / FHL1 / AF098518.1 / 0.6 0.0 (3) / 0.8 0.2 (3)
Discs, large homolog 7 (Drosophila) [KIAA0008] / DLG7 / NM_014750.1 / -0.8 0.0 (3) / -0.7 0.1 (2)
Tumor endothelial marker 1 precursor / TEM1 / NM_020404.1 / -0.7 0.3 (2) / -0.9 0.2 (2)
RNA & Protein Processing/Trafficking
Matrix metalloproteinase 1 (interstitial collagenase) / MMP1 / NM_002421.2 / 4.6 0.2 (3) / 4.7 0.4 (3)
Plasminogen activator, urokinase / PLAU / NM_002658.1 / 1.2 0.1 (3) / 1.2 0.1 (3)
Preprourokinase (urokinase-type plasminogen activator) / PLAU / K03226.1 / 1.1 0.1 (3) / 1.4 0.2 (3)
Tissue inhibitor of metalloproteinase 1 / TIMP1 / NM_003254.1 / 0.8 0.2 (2) / 0.6 0.1 (2)
Splicing factor, arginine/serine-rich 3 (pre-splicing factor) / SFRS3 / AF107405.1 / -0.9 0.2 (2) / -0.5 0.0 (2)
Splicing factor, arginine/serine-rich 7 (35 kDa) / SFRS7 / NM_006276.2 / -0.5 0.2 (2) / -0.6 0.0 (2)
Vacuolar protein sorting 41 (yeast homolog) / VPS41 / NM_014396.1 / -0.8 0.1 (2) / -0.6 0.1 (2)
Unknown / Uncharacterized
KIAA0247 gene product [unknown function] / KIAA0247 / NM_014734.1 / 0.9 0.1 (3) / 0.9 0.1 (3)
Clone DKFZp586G2120 [unknown function] / DKFZp586G2120 / AL136924.1 / 0.8 0.1 (2) / 0.8 0.2 (2)
Clone DKFZp761K0722 [unknown function] / DKFZp761K0722 / AL583911.1 / -0.7 0.1 (2) / -1.1 0.5 (2)
Clone DKFZp586E121 [unknown function] / DKFZp586E121 / AL050122.1 / -0.6 0.3 (2) / -1.0 0.6 (2)
Table S4. Genes induced by SF in the absence but not in the presence of DN-Akt @ T=48 hr.
DU-145 cells T=48 hr (2/1, 4/3 {[SF+pcDNA3]/pcDNA3, [SF+DN-Akt]/DN-Akt}Gene Name / Symbol / GeneBank
Accession No. / Log Signal Ratio
Mean SEM (N)
(SF+pcDNA3)/
pcDNA3 / (SF+DN-Akt)/
DN-Akt
Transcription Factors / Nuclear Proteins
Forkhead box D1 (FKHL8, FREAC4) [Forkhead family transcription factor] / FOXD1 / NM_004472.1 / 0.8 0.3 (2) / -
Nuclear transcription factor Y, beta / NFYB / NM_006166.2 / -0.9 0.1 (2) / -
Chromosome-associated polypeptide C (CAP-C) / SMC4L1 / NM_005496.1 / -0.8 0.1 (2) / -
Zinc finger protein 268 (also called HZF3) / ZNF268 / AF317549.1 / -0.8 0.1 (2) / -
Stress Response / Mitochondrial Proteins
Thioredoxin delta 3 (TXN delta 3) / TXND3 / AF065241.1 / -0.8 0.2 (2) / -
DNA Replication / Cell Cycle Progression
Wingless-type MMTV integration site family, member 4 / WNT4 / NM_030761.1 / 1.1 0.0 (2) / -
Kinesin-like 5 (mitotic kinesin-like protein 1) / KNSL5 / NM_004856.3 / -0.9 0.4 (2) / -
Asp (abnormal spindle)-like, microcephaly associated (Drosophila) / ASPM / NM_018123.1 / -0.8 0.1 (3) / -
AD024 (kinetochore protein Spc25) / Spc25 / AF225416.1 / -0.8 0.1 (2) / -
Cyclin L (also called BM-001, ania-6a, LOC57018) / CCNL1 / NM_020307.1 / -0.8 0.2 (2) / -
Centromere protein F (350/400 kDa, mitosin) / CENPF / NM_005196.1 / -0.8 0.1 (2) / -
Cell division cycle associated A3 (MGC2577, GRCC8, TOME-1) / CDCA3 / NM_031299.1 / -0.8 0.4 (2) / -
Centromere protein A (17 kD) / CENPA / NM_001809.2 / -0.8 0.2 (2) / -
Kinesin family member 14 (KIAA0042 gene product) / KIF14 / NM_014875.1 / -0.8 0.1 (2) / -
Signal Transduction
SPRY domain-containing SOCS box protein (FLJ22393) / SSB1 / NM_025106.1 / 0.8 0.1 (2) / -
Ligands and Receptors
Tyrosine kinase precursor ERK (Eph-like) [EPH receptor B2] / EPHB2 / D31661.1 / 1.9 0.3 (2) / -
Latent transforming growth factor beta binding protein 2 / LTBP2 / NM_000428.1 / 0.8 0.2 (3) / -
Hyaluronan-mediated motility receptor (RHAMM) transcript variant 2 / HMMR / NM_012485.1 / -1.0 0.2 (2) / -
Chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1) / CXCL12 / NM_000609.1 / -0.8 0.3 (2) / -
Metabolism
Adenosine monophosphate deaminase (isoform E) / AMPD3 / NM_000480.1 / 1.2 0.1 (2) / -
Transglutaminase 1 (ichthyosis congenita II) / TGM1 / M98478.1 / 0.8 0.2 (2) / -
Cytoskeleton / Cell Adhesion / Extracellular Matrix
Extracellular matrix protein 1 (also called secretory component p85) / ECM1 / U65932.1 / 1.3 0.2 (3) / -
Membrane & Transmembrane Proteins / Pore / Channels
PCDH-gamma-A3 gene, aberrantly spliced, sequence / AF152509.1 / 0.9 0.1 (2) / -
Mucolipin 3 (cation channel protein) [hypothetical protein FLJ11006] / MCOLN3 / NM_018298.1 / -0.9 0.1 (2) / -
Immune Response / Inflammation / Interferon-Responsive
TNFAIP3 interacting protein 1 (Nef-associated factor 1, NAF1) / TNIP1 / NM_006058.1 / 0.7 0.1 (3) / -
Differentiation / Development / Tissue-Restricted Expression
Synuclein, alpha (non A4 component of amyloid precursor) / SNCA / L36674.1 / -0.8 0.2(2) / -
RNA & Protein Processing/Trafficking
Matrix metalloproteinase 10 (stromelysin 2) / MMP10 / NM_002425.1 / 2.3 0.3 (2) / -
Urokinase-type plasminogen activator receptor / UPAR / U08839.1 / 1.0 0.3 (2) / -
Coagulation factor II (thrombin) receptor-like 1 / F2RL1 / NM_005242.2 / 0.9 0.0 (2) / -
PRP4 pre-mRNA processing factor 4 homolog B (yeast) [KIAA0536] / PRPF4B / AB011108.1 / -1.1 0.1 (2) / -
Splicing factor, arginine/serine-rich 14 (wr58g05.x1; KIAA0365) / SRFS14 / AI978718 / -0.9 0.4 (2) / -
Golgin-67 (also called 88-kDa Golgi protein, GM88) / GOLGIN-67 / AF204231.1 / -0.9 0.1 (2) / -
Coagulation factor VII, transcript variant 1 / F7 / NM_000131.2 / -0.8 0.3 (2) / -
Golgi autoantigen, golgin subfamily a, 5 / GOLGA5 / AF164622.1 / -0.8 0.1 (2) / -
Unknown / Uncharacterized
Basement membrane-induced gene (ICB-1) [? cell adhesion role] / C1orf38 / NM_004848.1 / 0.8 0.3 (2) / -
HT033 (also called NPD014 protein, hypothalamus library) / NPD014- / AF267856.1 / -1.0 0.1 (2) / -
Homo sapiens cDNA FLJ14046 fis / - / AK024108.1 / -0.9 0.2 (2) / -
DNA sequence from clone RP4-753D5 on chromosome 6p12.1-12.3 / - / AL049693 / -0.9 0.0 (2) / -
DKFZp434F205 / DKFZp434F205 / AL136877.1 / -0.8 0.1 (2) / -
NPD014 (also called DJ465N24.2.1) [function unknown] / NPD014 / AF247168.1 / -0.8 0.1 (2) / -
KIAA0586 protein [function unknown] / KIAA0586 / AB011158 / -0.8 0.2 (2) / -
DNA sequence from clone 522P13 on chromosome 6p21.31-22.3 / - / AL024509 / -0.8 0.5 (2) / -
DNA sequence from clone RP11-438F9 on chromosome 13 / - / AL390738 / -0.8 0.1 (2) / -
cDNA clone IMAGE:273538 3', mRNA sequence / - / N36928 / -0.8 0.1 (2) / -
Table S5. Genes induced by SF in the presence but not in the absence of DN-Akt @ T=48 hr.
DU-145 cells T=48 hr (4/3, 2/1 {[DN-Akt+SF]/DN-Akt], [pcDNA3+SF]/pcDNA3]}Gene Name / Symbol / GeneBank
Accession No. / Log Signal Ratio
Mean SEM (N)
(pcDNA3+SF)/
pcDNA3 / (DN-Akt+SF)/
DN-Akt
Transcription Factors / Nuclear Proteins
Transcription factor 20 (AR1, nuclear factor SPBP) / TCF20 / U19345.1 / - / -1.0 0.1 (2)
Breast and ovarian cancer susceptibility protein splice variant / BRCA1 / AF005068.1 / - / -0.9 0.2 (2)
Nuclear factor of activated T-cells 5, tonicity-responsive / NFAT5 / NM_006599.1 / - / -0.9 0.2 (2)
Global transcription activator homologous sequence / SNF2L1 / M88163.1 / - / -0.8 0.4 (2)
Stress Response / Mitochondrial Proteins
Peroxiredoxin 3 (PRO1748, antioxidant protein 1) / PRDX3 / AF118073.1 / - / -1.0 0.4 (2)
DNA Replication / Cell Cycle Progression
Kinesin family member 5A / KIF5A / NM_004984.1 / - / -1.3 0.1 (2)
Polymerase (RNA) III (DNA directed) (32 kDa) / RPC32 / NM_006467.1 / - / 1.0 0.4 (2)
NY-REN-55 antigen (NIMA-related kinase 1) / NEK1 / AF155113.1 / - / -1.1 0.1 (2)
Mutated in colorectal cancers (putative tumor suppressor) / MCC / NM_002387.1 / - / -1.1 0.2 (2)
Postmeiotic segregation increased 2-like 11 (PMSR6) / PMS2L11 / U38980 / - / -1.0 0.4 (2)
RAD51-like 3 (S. cerevisiae) [RAD51D] / RAD51L3 / AF034956 / - / -1.0 0.2 (2)
Deleted in lymphocytic leukemia, 2 (BCMS-upstream neighbor) / DLEU2 / AF264787.1 / - / -0.9 0.1 (2)
TTK protein kinase (also known as ESK, PYT, MPS1L1) / TTK / NM_003318.1 / - / -0.8 0.1 (2)
Signal Transduction
Protein phosphatase 1, regulatory (inhibitor) subunit 14D (FLJ20251) / PPP1R14D / NM_017726.1 / - / -1.6 0.2 (2)
Wingless-type MMTV integration site family, member 1 (INT1) / WNT1 / AI218134 / - / -1.3 0.3 (2)
IL2-inducible T-cell kinase (ITK, LYK, EMT) / ITK / D13720.1 / - / -1.2 0.3 (2)
Centaurin delta 1 (KIAA0580) / CENTD1 / AK023737.1 / - / -1.2 0.3 (2)
MAP kinase kinase MEK5c / MEK5C / U71088.1 / - / -1.1 0.0 (2)
PI-3-kinase, regulatory subunit, polypeptide p101 (P101-PI3K) / P101-PI3K / NM_014308.1 / - / -1.0 0.1 (2)
Signaling lymphocytic activation molecule family 1 (SLAM, CD150) / SLAMF1 / NM_003037.1 / - / -0.9 0.0 (2)
Protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform / PPP2CB / AI762547 / - / -0.9 0.0 (2)
RAN binding protein 2 / RANBP2 / NM_006267.2 / - / -0.8 0.2 (2)
Ligands and Receptors
PPAR (gamma) angiopoietin related protein / PGAR / NM_016109.1 / - / 1.0 0.6 (2)
Amphiregulin (schwannoma-derived growth factor) / AREG / NM_001657.1 / - / 0.8 0.3 (2)
Chemokine (C-C motif) ligand 2 [MCP-1, HC11, SCYA2, MCAF] / CCL2 / S69738.1 / - / 0.8 0.3 (2)
Purinergic receptor (family A group 5) / P2Y5 / NM_005767.1 / - / -1.4 0.3 (2)
T cell receptor, clone IGRA17 / - / X61072.1 / - / -1.3 0.1 (2)
Spinal cord-derived growth factor-B (SCDGF-B) / SCDGFB / NM_025208.1 / - / -1.2 0.7 (2)
DNA for HBV integration sites (retinoic acid receptor-B) / RARB / X04014 / - / -1.2 0.3 (2)
Glutamate receptor, metabotropic 6 . / GRM6 / NM_000843.2 / - / -1.1 0.3 (3)
Pyrimidinergic receptor P2Y, G-protein coupled, 4 / P2RY4 / NM_002565.1 / - / -1.1 0.1 (2)
Alternatively spliced endothelial thromboxane A2 receptor / TBXA2R / U11271.1 / - / -0.9 0.1 (2)
Metabolism
Spermidinespermine N1-acetyltransferase / SAT / NM_002970.1 / - / 0.8 0.3 (2)
Manganese containing superoxide dismutase (EC 1.15.1.1) / SOD2 / X15132.1 / - / 0.8 0.1 (2)
Glycosyltransferase-like 1 (PRO0159 protein) / GTDC1 / NM_014118.1 / - / -1.6 0.4 (2)
CYP450, family 2, subfamily C, polypeptide 9 / CYP2C9 / M21940.1 / - / -1.1 0.2 (2)
HUMCPIIA3A cytochrome P450IIA3 / CYP2A3 / M33318 / - / -1.1 0.4 (2)
Cytochrome P450, subfamily I, polypeptide 2 / CYP1A2 / NM_000761.2 / - / -1.3 0.3 (2)
Hypothetical methylthioadenosine phosphorylase fusion protein / MTAP / AF109294.1 / - / -1.0 0.0 (2)
Interleukin 1-beta converting enzyme isoform gamma (caspase-1) / CASP1 / U13698.1 / - / -0.9 0.1 (2)
Flavin containing monooxygenase 4 / FMO4 / NM_002022.1 / - / -0.9 0.2 (2)
Glutathione peroxidase 3 (plasma) / GPX3 / NM_002084.2 / - / -0.8 0.1(2)
Gamma-glutamyltransferase 1, transcript variant 3, / GGT1 / NM_013430.1 / - / -0.8 0.3 (2)
Cytoskeleton / Cell Adhesion / Extracellular Matriz
Fibromodulin (interstitial proteoglycan) / FMOD / NM_002023.2 / - / -1.3 0.3 (2)
Melanophilin (MGC2771, MELPH) / MLPH / NM_024101.1 / - / -1.3 0.3 (2)
Hermansky-Pudlak syndrome 1 (organelle biogenesis) / HPS1 / NM_000195.1 / - / -0.9 0.0 (3)
Membrane & Transmembrane Proteins / Pore / Channels
ATP-binding cassette, sub-family A (ABC1), member 1 / ABCA1 / NM_005502.1 / - / -1.3 0.3 (2)
FXYD domain-containing ion transport regulator 3, transcript variant 1 / FXYD3 / NM_005971.2 / - / -1.2 0.3 (2)
Solute carrier family 5 (sodium iodide symporter), member 5 / SLC5A5 / D87920.1 / - / -1.2 0.2 (2)
K+ large conductance Ca+2 activated channel, subfamily M, , 4 / KCNMB4 / NM_014505.1 / - / -1.1 0.1 (2)
Organic cationic transporter-like 4 / ORCTL4 / NM_004803.2 / - / -1.1 0.2 (2)
Membrane protein, palmitoylated 3 (MAGUK p55 subfamily memb. 3 / MPP3 / NM_001932.1 / - / -1.0 0.3 (2)
Cadherin 10, type 2 (T2-cadherin) / CDH10 / NM_006727.1 / - / -1.0 0.3 (2)
ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 / ATP6V0D1 / AK001155.1 / - / -0.9 0.2 (2)
Claudin 10 (tight junction protein) / CLDN10 / NM_006984.1 / - / -0.8 0.2 (3)
Immune Response / Inflammation / Interferon-Responsive
CD53 antigen (CD53 tetraspan antigen, cell surface glycoprotein) / CD53 / NM_000560.1 / - / -1.4 0.1 (2)
Peptidoglycan recognition protein 4 (SBBI67, LOC57115) / PGLYRP4 / NM_020393.1 / - / -1.3 0.2 (2)
CD80 antigen (CD28 antigen ligand 1, B7-1 antigen) / CD80 / NM_005191.1 / - / -1.2 0.0 (2)
Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide / FCER1G / NM_004106.1 / - / -1.1 0.3 (2)
Pancreatitis-associated protein (HIP, PAP1) / PAP / NM_002580.1 / - / -0.9 0.2 (2)
Lymphocyte antigen 6 complex, locus G5C / LY6G5C / NM_025262.1 / - / -0.9 0.1 (2)
Killer cell lectin-like receptor subfamily G, member 1 (MAFA-L) / KLRG1 / AF081675.1 / - / -0.8 0.1 (2)
Differentiation / Development / Tissue-Restricted Expression
Paired box gene 8 (PAX8), transcript variant PAX8E / PAX8E / NM_013992.1 / - / 0.8 0.2 (2)
Pregnancy-specific beta-1-glycoprotein / PSG95 / M34715.1 / - / -1.4 0.1 (2)
Cylicin, basic protein of sperm head cytoskeleton 2 / CYLC2 / NM_001340.1 / - / -1.4 0.2 (2)
Paired mesoderm homeo box 1 transcript variant pmx-1a / PMX1 / NM_006902.2 / - / -1.2 0.1 (2)
Pregnancy specific beta-1-glycoprotein 4 / PSG4 / NM_002780.1 / - / -1.2 0.1 (2)
Tumor protein p73-like [CUSP autoantigen, member of p53 family] / TP73L / AF091627.1 / - / -1.1 0.1 (3)
Dopamine receptor D2 / DRD2 / NM_000795.1 / - / -1..1 0.1 (2)
Placental protein 13-like protein / LOC56891 / NM_020129.1 / - / -1.1 0.1 (2)
Cylicin, basic protein of sperm head cytoskeleton 1 / CYCL1 / Z22780.1 / - / -1.0 0.0 (2)
Neurotensin (neurotransmitter/neuromodulator) / NTS / NM_006183.2 / - / -1.0 0.1 (3)
Myosin, light polypeptide 4, alkali; atrial, embryonic / MYL4 / AF116676.1 / - / -0.9 0.2 (2)
Embryonic myosin alkali light chain / MLC1 / M36172.1 / - / -0.8 0.1 (2)
Apoptosis / Cell Survival
Cell death-inducing DFFA-like effector c (similar to FSP27) / CIDEC / NM_022094.1 / - / -1.3 0.1 (2)
RNA & Protein Processing/Trafficking
E3 ubiquitin ligase Smurf2 / SMURF2 / AY014180.1 / - / 1.0 0.4 (2)
Chediak-Higashi syndrome protein short isoform (LYST) / CHS1 / U84744.1 / - / -1.4 0.2 (2)
Acrosomal vesicle protein 1 transcript variant 1 / ACRV1 / NM_001612.2 / - / -1.2 0.4 (2)
Syntaxin binding protein 6 (amisyn) [HSPC156 protein] / STXBP6 / NM_014178.1 / - / -1.1 0.1 (2)
Acrosomal vesicle protein 1, transcript variant 5 / ACRV1 / NM_020109.1 / - / -1.1 0.2 (3)
Disintegrin metalloproteinase with thrombospondin repeats / ADAMTS9 / NM_020249.1 / - / -1.1 0.2 (3)
A disintegrin and metalloproteinase domain 21 / ADAM21 / NM_003813.1 / - / -1.0 0.2 (2)
Ret finger protein-like 3 (RING finger protein (? ubiquitin ligase) / RFPL3 / NM_006604.1 / - / -1.0 0.2 (2)
Apobec-1 complementation factor; APOBEC-1 stimulating protein / ACF / NM_014576.1 / - / -0.9 0.3 (2)
nipsnap homolog 3B (C. elegans) [FLJ11275] / NIPSNAP3B / NM_018376.1 / - / -0.9 0.1 (2)
WW domain binding protein 4 (forming binding protein 21) (WBP4) / WBP4 / NM_007187.2 / - / -0.9 0.3 (2)
Ribosomal protein L38, clone MGC:1637 / RPL36 / BC000603.1 / - / -0.8 0.0 (2)
Matrix metalloproteinase 9 (gelatinase B, 92kD type IV collagenase) / MMP9 / NM_004994.1 / - / -0.8 0.2 (2)
Unknown / Uncharacterized
cDNA, 5 end /clone=IMAGE-299518 /clone_end=5 / - / W05463 / - / 1.1 0.1 (2)
Potential tumor suppressor ST7 (TSG7, HELG) / ST7 / NM_013437.1 / - / 0.9 0.4 (2)
FLJ13695 fis, clone PLACE2000124. / - / AK023757.1 / - / -1.5 0.2 (2)
Endogenous retrovirus H D1 leader region integrase-derived ORF1,2 / HSU88895 / NM_015870.1 / - / -1.3 0.3 (2)
TP53TG3 protein [function unknown] / TP53TG3 / NM_015369.1 / - / -1.2 0.1 (2)
DKFZp586O1318 [function unknown] / DKFZp586O1318 / AL049390.1 / - / -1.1 0.1 (2)
Clone 24487 sequence [function unknown] / - / AF070579.1 / - / -1.0 0.2 (2)
Hypothetical protein FLJ21168 / FLJ21168 / NM_025073.1 / - / -1.0 0.1 (3)
Hypothetical protein PRO2849 / PRO2849 / NM_022335.1 / - / -1.0 0.1 (2)
yv43e09.s1 cDNA, 3 end / - / N53555 / - / -1.0 0.2 (2)
Zinc finger protein KOX23 (ZK23) / KOX23 / AA429615 / - / -1.0 0.2 (2)
Full length insert cDNA clone EUROIMAGE 208948 / - / AL109716.2 / - / -1.0 0.3 (3)
DKFZp434D044. / DKFZp434D044 / AL096729.1 / - / -0.9 0.1 (2)
T-cell leukemia translocation altered gene / TCTA / NM_022171.1 / - / -0.9 0.1 (2)
UI-H-BI0p-aax-a-07-0-UI.s1 cDNA, 3 end / - / AW014299 / - / -0.9 0.2 (2)
Hono sapiens 59 protein, 3 end / - / L19267 / - / -0.9 0.2 (2)
Hypothetical protein MGC4170 / MGC4170 / NM_024312.1 / - / -0.9 0.4 (2)
Dentatorubral-pallidoluysian atrophy (atrophin-1) / DRPLA / D31840 / - / -0.8 0.1 (2)
Hypothetical protein FLJ13611 / FLJ13611 / NM_024941.1 / - / -0.8 0.1 (2)
Hypothetical protein FLJ23558 / FLJ23558 / NM_025095.1 / - / -0.8 0.1 (2)
nc25b01.r1 cDNA / - / AA225490 / - / -0.8 0.2 (2)
Zinc finger protein 576 (MGC2508) / ZNF576 / NM_024327.1 / - / -0.8 0.1 (2)
Wu95h10.x1 cDNA, 3 end / - / AW025284 / - / -0.9 0.2 (2)
DKFZp434M1928_s1 cDNA, 3 end / - / AL044097 / - / -0.8 0.3 (2)
v05a04.s1 cDNA, 3 end /clone=IMAGE-241806 /clone_end=3 / - / H93077 / - / -0.8 0.4 (3)
Table S6. Comparison of gene expression in cells transfected with DN-Akt vs pcDNA3 @ T=6 hr1.
1DU-145 cells were transfected overnight (with DN-AKT or empty pcDNA3 vector), then washed, then allowed to recover for several hours. After that, they were sham-treated for T=6 hr (as a control for the SF experiments), prior to harvesting for RNA isolation.
DU-145 cells T=6 hr (3/1) DN-Akt/pcDNA3Gene Name / Symbol / GeneBank Accession No. / Log Signal Ratio
Mean SEM (N)
Transcription Factors / Nuclear Proteins
Breast and ovarian cancer susceptibility protein splice variant / BRCA1 / AF005068.1 / 2.9 0.3 (3)
Ets2 repressor factor / ERF / NM_006494.1 / 0.9 0.0 (2)
Heterogeneous nuclear ribonucleoprotein H1 (H). / HNRPH1 / NM_005520.1 / 0.9 0.1 (2)
DNA Replication / Cell Cycle Progression
Cyclin-E binding protein 1 / LOC51191 / NM_016323.1 / 0.8 0.1 (3)
Signal Transduction
MAP kinase kinase MEK5c / MEK5C / U71088.1 / 3.4 0.3 (2)
Eps8 binding protein e3B1 (Abl-interactor 1) / ABI1 / AF006516.1 / 0.8 0.1 (2)
Erbb2-interacting protein (LOC55914) / ERBB2IP / NM_018695.1 / 0.8 0.1 (2)
Ligands and Receptors
Inhibin, beta C / INHBC / NM_005538.1 / 1.0 0.3 (2)
Metabolism
Acyl-coenzyme A: cholesterol acyltransferase / ACAT / L21934.2 / 0.8 0.1 (2)
Membrane & Transmembrane Proteins / Pore / Channels
Phospholipid scramblase 1 / PLSCR1 / NM_021105.1 / 1.0 0.2 (3)
Immune Response / Inflammation / Interferon-Responsive
Interferon-induced protein with tetratricopeptide repeats 1 / IFIT1 / NM_001548.1 / 2.3 0.1 (3)
Interferon, alpha-inducible protein (clone IFI-6-16), transcript variant 3 / GIP3 / NM_022873.1 / 1.6 0.1 (2)
Interferon-stimulated protein, 15 kDa. / ISG15 / NM_005101.1 / 1.4 0.3 (3)
Myxovirus (influenza) resistance 1 / MX1 / NM_002462.1 / 1.4 0.2 (3)
Interferon-induced protein with tetratricopeptide repeats 4 / IFIT4 / NM_001549.1 / 1.2 0.2 (2)
2-5 Oligoadenylate synthetase 3 / OAS3 / NM_006187.1 / 1.1 0.1 (3)
Interferon induced transmembrane protein 2 (1-8D) / IFITM2 / NM_006435.1 / 1.0 0.1 (3)
Interferon regulatory factor 7, transcript variant c / IRF7 / NM_004030.1 / 0.8 0.1 (3)
Differentiation / Development / Tissue-Restricted Expression
Melanoma differentiation associated protein-5 / MDA5 / NM_022168.1 / 2.1 0.6 (2)
RNA & Protein Processing
Tyrosine aminotransferase (TAT), nuclear gene encoding mitochondrial prot. / TAT / NM_000353.1 / 1.0 0.1 (2)
UBBP1 pseudogene for ubiquitin UBB / UBBP1 / X04801 / 0.8 0.1 (3)
U2 small nuclear ribonucleoprotein auxiliary factor (65Kd). / U2AF65 / NM_007279.1 / 0.8 0.3 (2)
Cell division cycle 5-like (KIAA0432) / CDC5L / AB007892.1 / 0.8 0.4 (2)
Chediak-Higashi syndrome protein short isoform (CHS) / LYST / U84744.1 / 0.8 0.2 (2)
Unknown / Uncharacterized
DNA sequence from clone RP1-138B7 on chromosome 20q13.12 / - / Z98752 / 1.0 0.4 (2)
Clone DKFZp566J0124 / DKFZP566J0124 / AL050038.1 / 1.0 0.2 (2)
Hypothetical protein FLJ12975 / FLJ12975 / NM_024809.1 / 0.9 0.4 (2)
Table S7. Comparison of gene expression in cells transfected with DN-Akt vs pcDNA3 @ T=48 hr1.
DU-145 cells T=48 hr (3/1) DN-Akt/pcDNA3Gene Name / Symbol / GeneBank Accession No. / Log Signal Ratio
Mean SEM (N)
Transcription Factors / Nuclear Proteins
Breast and ovarian cancer susceptibility protein splice variant / BRCA1 / AF005068.1 / 2.0 0.4 (3)
Signal Transduction
MAP kinase kinase MEK5c / MEK5C / U71088.1 / 2.0 0.1 (2)
Metabolism
Beta3GalNAcT-1 for globoside synthase (membrane-bound glycoprotein enzyme) / B3GALT3 / AB050855.1 / 0.9 0.2 (2)
Ligands and Receptors
Retinoic acid receptor, beta / RARB / NM_000965.1 / 0.9 0.1 (2)
Membrane & Transmembrane Proteins / Pore / Channels
Transient receptor potential channel 3 / TRPC3 / NM_003305.1 / 0.8 0.3 (2)
SEC24 (S. cerevisiae) related gene family, member D (vesicle trafficking) / SEC24D / NM_014822.1 / 0.8 0.1 (2)
Immune Response / Inflammation / Interferon-Responsive
Interferon, alpha-inducible protein (clone IFI-6-16), transcript variant 3 / G1P3 / NM_022873.1 / 0.9 0.5 (2)
Cutaneous T cell lymphoma-associated antigen 1 / CTAGE1 / NM_022663.1 / 0.9 0.1 (2)
Unknown / Uncharacterized
Plexin domain containing 1 (clone 24787 sequence) / PLXDC1 / AF070526.1 / 1.1 0.1 (2)
1DU-145 cells were transfected overnight (with DN-AKT or empty pcDNA3 vector), then washed, then allowed to recover for several hours. After that, they were sham-treated for T=48 hr (as a control for the SF experiments), prior to harvesting for RNA isolation.
Table S8. Comparison of DU-145 cells transfected with DN-Akt vs pcDNA3 and treated with HGF/SF @ T=6 hr.
DU-145 cells T=6 hr (4/2) [DN-Akt+SF]/[pcDNA3+SF]Gene Name / Symbol / GeneBank Accession No. / Log Signal Ratio
Mean SEM (N)
Transcription Factors / Nuclear Proteins
Breast and ovarian cancer susceptibility protein splice variant / BRCA1 / AF005068.1 / 2.8 0.9 (3)
TP53TG3 protein / TP53TG3 / NM_015369.1 / 0.9 0.0 (2)
Signal Transduction
MAP kinase kinase MEK5c / MEK5C / U71088.1 / 1.5 0.4 (3)
Immune Response / Inflammation / Interferon-Responsive
Signaling lymphocytic activation molecule / SLAM / NM_003037.1 / 1.0 0.3 (2)
Differentiation / Development / Tissue-Restricted Expression
Paired mesoderm homeo box 1, transcript variant pmx-1a / PMX1 / NM_006902.2 / 1.0 0.3 (2)
Pregnancy-specific beta-1-glycoprotein / PSG95 / M34715.1 / 0.9 0.1 (2)
Unknown / Uncharacterized
Hypothetical protein FLJ10613 (putative GTP binding protein, unknown function) / FLJ10613 / NM_019067.1 / 1.2 0.0 (2)
SLD5 homolog (also known as MGC14799; unknown function) / SLD5 / BC005995.1 / 0.9 0.0 (2)
Table S9. Comparison of cells transfected with DN-Akt vs pcDNA3 and treated with HGF/SF @ T=48 hr.
DU-145 T=48 hr (4/2) [DN-Akt+SF]/[pcDNA3+SF]Gene Name / Symbol / GeneBank Accession No. / Log Signal Ratio
Mean SEM (N)
Transcription Factors / Nuclear Proteins
Breast and ovarian cancer susceptibility protein splice variant / BRCA1 / AF005068.1 / 1.8 ( 0.2 (3)
Zinc finger protein 268 (also called HZF3; a KRAB box family protein) / ZNF268 / AF317549.1 / 1.2 ( 0.8 (2)
RB1-inducible coiled-coil 1 (KIAA0203; transcriptional regulator of RB1) / RB1CC1 / NM_014781.1 / 1.0 ( 0.3 (2)
Transcription factor, E4TF1-60 (also called NRF2, GABPA) / NRF2 / D13318.1 / 0.8 ( 0.2 (2)
Zinc finger protein 643 (LOC65243; KARB Box family protein) / ZNF643 / NM_023070.1 / -0.8 ( 0.0 (2)
Stress Response / Mitochondrial Proteins
Similar to FK506 binding proteins (molecular chaperone) / FKBP10 / NM_021939.1 / -0.9 ( 0.2 (2)
DNA Replication / Cell Cycle Progression
X-ray repair complementing defective repair 4 transcript variant 2 / XRCC4 / NM_022406.1 / 0.8 ( 0.5 (2)
Ligase IV, DNA, ATP-dependent / LIG4 / NM_002312.1 / 0.8 ( 0.1 (2)
Signal Transduction
MAP kinase kinase MEK5c / MEK5C / U71088.1 / 1.4 0.2 (3)
Tousled-like kinase 1 (nuclear serine/threonine kinase; chromatin assembly) / TLK1 / AF162666.1 / 0.8 0.2 (2)
Ras oncogene family protein RAB11B (also called H-YPT3) / RAB11B / X79780 / -0.7 0.4 (2)
Ligands and Receptors
Hyaluronan-mediated motility receptor (RHAMM) transcript variant 2, / HMMR / NM_012485.1 / 0.8 0.3 (2)
Membrane & Transmembrane Proteins / Pore / Channels
Amyloid A4(751) protein (homologous to serine proteinase inhibitor) / APP / X06989.1 / -0.7 0.1 (2)
Cell Survival / Apoptosis
BAX delta (BCL2-associated X protein, isoform delta) / BAX / U19599.1 / -0.7 0.2 (2)
Differentiation / Development / Tissue-Restricted Expression
Progesterone-induced blocking factor 1 (C13orf24) / PIBF1 / NM_006346.1 / 0.9 0.3 (2)
Neurotensin (may function as neurotransmitter or neuromodulator) / NTS / NM_006183.2 / 0.9 0.1 (2)
RNA & Protein Processing / Trafficking
SNF7 domain containing 2 (C9orf83) [? Role in vesicular trafficking] / SNF7DC2 / NM_016410.1 / 0.8 0.1 (2)
Table S10. PCR Primers used for real-time quantitative RT-PCR assays.
Gene name / Symbol / Primer sequences (5’3’) / GeneBank Acession NoEphrin receptor EphB2 / EPHB2 / Sense: cgtgtttgagtcaagccaga
Antisense: gctgcaatggtatccacctt / D31661.1