DRAFT SCPE TE Manuscript

Long-term T-DNA insert stability and transgene expression consistency in field propagated sugarcane

Kerry Hosmer Caffall1*, Chengkun He1*,**, Michele Smith-Jones2, Kristin Mayo1, Pearl Mai1, Shujie Dong1, John Ke1, Erik Dunder1, Michele Yarnall1, Rachel Whinna1, Joe DeMaio1, Weining Gu1, Judith Sheldon4, Martin Allen1, Tricia Costello1, Kristin Setliff1, Rakesh Jain3, Ada Snyder3, Clark Lovelady3, Eric Rawls3, Eric Palmer3,Yan Zhang1, Nicholas Bate1, Liang Shi1, Ian Jepson1

Contact Information:

1 Syngenta Crop Protection, LLC, 9 Davis Drive, Research Triangle Park, NC 27709-2257, USA

2 Syngenta Seeds Incorporated, 2369 330th Street, Slater, IA 50244, USA

3 Syngenta Crop Protection, LLC, Vero Beach Research Center, 7145 58th Avenue, Vero Beach FL 32967, USA

4 Syngenta Jealott’s Hill Research Center, Bracknell, Berkshire RG42 6EY, UK

* Co-first author

**Correspondence:

Chengkun He

Tel: +1-919-281-7413

Vector construction

The AmCYAN1 DNA fragment was PCR-amplified from pAmCYAN1-N1 (Cat#632442, Clontech, Mountain View, CA. USA) with addition of a BamHI site at the 5’ end and a SacI site at the 3' end; The BamHI-SacI fragment containing the AmCYAN1 sequence was ligated into TOPO2.1 by TA cloning, resulting in the vector pCR2.1AmCYAN1. The vector pCR2.1AmCYAN1 was sequenced usingM13 reverse primer and M13 forward primer. The AmCYAN1fragment was released by BamHI/SacI digestion from pCR2.1AmCYAN1 and ligated into pNOV4633 between BamHI and SacI site to create the prCMP-AmCYAN1-tNOS cassette. Then the AmCYAN1 expression cassette was excised as a HindIII/EcoRI fragment and ligated into a binary vector which contained prUbi-PMI-tNOS expression cassette between HindIII and EcoRI site to create the Vector #1(Supplementary Fig. 1S), or ligated into a different binary vector which contained prCMP-PMI-tNOS expression cassette between HindIII and EcoRI site to create the Vector #2 (Supplementary Fig. 2S).

Supplementary Fig. 1SMap of vector #1.Vector #1 is digested with HindIII, and probed with AmCYNA1, a 1.5-kb band is shown (Fig 3A, E&F, I), digested with NdeI, and probed with AMCYAN1, a 8.7-kb band is shown (Fig 3A, E&F, I); Vector #1 is digested with HindIII, and probed with PMI, a 9.1-kb band is shown (Fig 3B, G&H, J), digested with NdeI and probed with PMI, a 8.7-kb band is shown (see Fig 3B, G&H, J), digested with SpeI, and probed with PMI, a 10.7-kb band is shown (Fig. 3G&H, J)

Supplementary Fig. 2SMap of vector 2.Vector #2 is digested with NdeI, and probed with AmCYNA1, a 9.5-kb band is shown (see Fig 3C); Vector #2 is digested with SphI, and probed with PMI, a 7.3-kb band is shown (see Fig 3D)

qPCR

T-DNA copy number in transgenic events was estimated by quantitative real-time PCR analysis (qPCR). Before the transgenic seedlings being sent to the greenhouse, qPCR was performed to estimate the T-DNA copy number of transgenic events; before the transgenic plants being transplanted to the big pots, another qPCR was performed to confirm the T-DNA copy number of transgenic events. Duplicate samples from each event were collected for qPCR. Two standard leaf punches were collected into a 96-well block containing a 0.5-cm steel-coated bead per well on dry ice, and stored at -80˚C until DNA isolation. Frozen tissue in block wells was ground for one minute in a Kleco grinder at maximum setting. Blocks were centrifuged briefly to pellet the particulate. DNA was extracted following the manufacturer’s protocol, with Wizard®Magnetic 96 DNA Plant System and Wash Buffer (FF3761 and A3811, Promega Corp. Fitchburg, WI. USA). qPCR reactions were multiplexed to simultaneously amplify the sugarcane endogenous alcohol dehydrogenase (SpAdh) DNA fragment and AmCYAN1 or PMI fragment. The following qPCR mix was prepared: 1.6 μL ddH2O; 5 μL 2× Jump StartTMTaqReadyMixTM (Sigma, St. Louis, MO. USA); 0.2 μLSpAdh primers and probe mix and 0.2 μLAmCYAN1 or PMI primers and probe mix to a final concentration of 300 nM forward primer, 300 nM reverse primer and 100 nM probe. 7 μL of qPCR mix was added to each well in a 384-well qPCR plate. 3 μLof sugarcane genomic DNA was loaded into the 384-well qPCR plate. The plate was sealed with optically clear heat seal film followed by a short spin in a centrifuge. All qPCR reactions were performed using an ABI Prism 7900HT Sequence Detection machine (Perkin-Elmer Applied Biosystems, Foster City, CA. USA). The thermal cycling conditions included an initial denaturation step at: 95°C for 5 min followed by 40 cycles of 5 sec at 95°C and 30 sec at 60°C. The PCR amplicons were measured at each cycle by reading the fluorescence signals. Primersequences are: AmCYAN1 forward, CCAGTTCCACACCTCCTACAAGA, AmCYAN1 reverse, CCTTGTCCAGGTCGGTTCTG, AmCYAN1probe: ACCATGCCCCCCAACCACGTG; PMI forward, CCGGGTGAATCAGCGTTT, PMI reverse, GCCGTGGCCTTTGACAGT, PMI probe: TGCCGCCAACGAATCACCGG; Sugarcane endogenous assay, SpAdhforward, TGCGCGTCAAGATCCTCTT, SpAdh reverse, CCCTTGGCCTCCCAGAAGT, SpAdh probe, ACCTCGCTCTGCCACACCGACGT. Efficiency of qPCR assays are listed below: efficiency of AmCYAN1 assay, 0.99; efficiency of PMI assay, 0.99; and efficiency of Sugarcane endogenous assay, SpAdh,1.00.

Supplementary Fig. 3SAmCYAN1 protein detection in sugarcane root tissues.AmCYAN1 protein fluorescence in root tips (left) and maturing roots in the elongation zone (right) in sugarcane event S502A004C (top) and untransformed (bottom) was visualized by confocal microscopy. Each panel displays the CFP channel, white light, and merged picture.

Supplementary Table 1SCopy numbers of sugarcane transgenic lines used in field testing

Variety / Event ID / Copy number by qPCR / Copy number by Southern blot / Vector
PMI / AmCYAN1 / PMI / AmCYAN1
SP 70-1143 / S300A002A / 2 / 2 / 2 / 2 / Vector #1
SP 70-1143 / S300A003B / > 2 / 2 / 3 / 2 / Vector #1
CP 84-1198 / S502A003B / 2 / 1 / 2 / 1 / Vector #1
CP 84-1198 / S502A004C / 1 / 1 / 1 / 1 / Vector #1
CP 84-1198 / S502A007A / 1 / 1 / NA / NA / Vector #1
CP 84-1198 / S502A020A / 1 / 1 / NA / NA / Vector #1
CP 84-1198 / S502A035A / 1 / 1 / NA / NA / Vector #1
L 97-128 / S501A004A / 1 / 1 / NA / NA / Vector #1
L 97-128 / S501A011A / 1 / 1 / NA / NA / Vector #1
L 97-128 / S501A012A / 1 / 2 / NA / NA / Vector #1
L97-128 / S100A001A / 1 / 1 / NA / NA / Vector #1
L97-128 / S700A069A / 1 / 1 / NA / NA / Vector #1
L97-128 / S700E108A / 1 / 1 / NA / NA / Vector #1
L97-128 / S700E219A / 1 / 1 / NA / NA / Vector #1
L97-128 / S900A008A / 1 / 1 / 1 / 1 / Vector #1
L97-128 / S900A013A / 1 / 1 / 1 / 1 / Vector #1
L 97-128 / S209A024A / 2 / 2 / 2 / 2 / Vector #2

Supplementary Table 2S ANOVA analysis of AmCYAN1 protein accumulation in ratoon generations

Event ID / df. Between / df. Error / df. total / F value / p value
S501A004A / 3 / 16 / 19 / 4.393 / 0.02*
S502A003B / 3 / 16 / 19 / 3.617 / 0.036*
S502A004C / 3 / 16 / 19 / 9.114 / 0.0009**
S300A002A / 3 / 16 / 19 / 44.87 / < 0.0001**
S300A003B / 3 / 16 / 19 / 63.91 / < 0.0001**
S900A008A / 3 / 16 / 19 / 0.4177 / 0.74
S900A013A / 3 / 16 / 19 / 3.621 / 0.036*
S502A007A / 3 / 16 / 19 / 28.03 / < 0.0001**
S501A011A / 3 / 13 / 16 / 4.772 / 0.019*
S501A012A / 3 / 16 / 19 / 5.564 / 0.0083**
S100A001A / 3 / 16 / 19 / 4.329 / 0.021*
S502A020A / 3 / 16 / 19 / 8.129 / 0.0016**
S502A035A / 3 / 16 / 19 / 7.603 / 0.0022**
S700A069A / 3 / 16 / 19 / 14.84 / < 0.0001**
S700E108A / 3 / 16 / 19 / 4.079 / 0.025*
S700E219A / 3 / 16 / 19 / 7.476 / 0.0024**
S209A024A / 3 / 16 / 19 / 4.556 / 0.017*