Hic-5 Controls BMP4 Responses in Prostate Epithelial Cells Through Interacting with Smads

Hic-5 Controls BMP4 Responses in Prostate Epithelial Cells through Interacting with Smads 1, 5 and 8

Dorjee T.N. Shola1,2, Hui Wang1,3, Reema Wahdan-Alaswad1,3 and David Danielpour1,3,4

1Case Comprehensive Cancer Center Research Laboratories, The Division of General Medical Sciences-Oncology, 2Department of Molecular Biology and Microbiology,3Department of Pharmacology,Case Western Reserve University, and 4Department of Urology, University Hospitals of Cleveland, Cleveland, Ohio, USA

Supplementary Methods and Figures

Reagents:Hic-5 antibody (#611165) was from BD TransductionLaboratories (San Jose, CA, USA). Recombinant human BMP4 and anti-Smad8 antibody (AF2309)were from R&D Systems, Inc., (Minneapolis, MN). Anti-Myc tag (A-14, sc-789), anti-Smad1 (SC-7965) and anti-Id1 (SC-427) antibodies were from Santa CruzBiotechnology (Santa Cruz, CA, USA). Anti--actin (#5441),anti-FLAG M1 (F-3040) and M2 (F3165) antibodies were from Sigma (St Louis, MO, USA). Anti-phospho-Smad-1/5/8 antibody (#9511), anti-Smad1(#9743) and anti-Smad5 (#9517)antibodies were from Cell Signaling Technology,Inc. (Danvers, MA, USA). Dulbecco’smodified Eagle’s medium/Ham’s F-12DMEM/F-12 (1:1) was from Invitrogen,Carlsbad, CA. Characterized fetal bovineserum (FBS) was from (HyClone Inc., Logan, UT). LDN-193189 was purchased from Stemgent, MA, insulin was from BioSource International (Camarillo, CA), IGF-1 was from Gropep (Australia) and hydrogen peroxide (#7722-84-1) was from Fisher Scientific, PA.

Plasmids:The cDNA fragment of Hic-5 (short or β- isoform) its truncations and paxillin were constructed as described(Wang et al., 2008; Wang et al., 2005). The Smads 1 (Accession number U59423), 5 (Accession number AF009678) & 8 (Accession number NM_005905) and its truncations were PCR amplified (Expand High Fidelity, Roche Applied Science) using a human prostatic cDNA library (pLIB-prostate, Clontech) as template and the primers (eurofins MWG Operon), which are listed in Table 1. The DNA fragments thus amplified were ligated into FLAG (5’) tagged pcDNA3 (Chipuk et al., 2002). The Id-1 promoter luciferase construct was generated by amplifying a 1663bp DNA fragment encompassing -1433 to +230from the human Id-1 gene transcriptional initiation site and cloned into SacI and XhoI site of pGL3-Basic vector (Promega). All the DNA sequences were confirmed by sequencing (Biotic Solutions) and Western blot analysis if relevant. The GST fusion protein was purified with glutathione-SepharoseTM4Bbeads (Amersham Biosciences).

In Vitro Transcription & Translation and GST pull-down:The in vitro transcription and translation of Myc-Hic-5 was carried out using TnT®CoupledReticulocyte Lysate Systems (Promega). The protein thus generated was stabilized with 1x Complete Mini-EDTA-freeProtease Inhibitor Mixture (Roche) and 1 mM phenylmethylsulfonyl fluoride.Twentyμl of this product was added to affinity-purified GST or GST-Smad fusions in the presence of pre-washedglutathione-SepharoseTM 4B beads (Amersham Biosciences).After overnight binding at 4°C with gentle rocking, the resin was washed twice with cold RIPA buffer (Wang et al., 2005),and cold PBS, and heated to 70 °C for 10 min with 50 μl of SDS-PAGE sampleloading buffer. The eluates were then immunoblotted.

Lentiviral shRNA construct preparation:All lentiviral vectors were from Trono’s laboratory (Cambridge, MA, USA) (Wiznerowicz and Trono, 2003) and obtained from Addgene, Inc. (Cambridge, MA).The Hic-5 shRNA lentiviral knock-out DU145 (passage 3-12) and PC3 (passage 5-14) cells used in this study were the same as described in (Wang et al., 2008). Targeting Hic-5 nucleic acid 317-345 (Rahman et al., 2003) wasused to silence Hic-5. The dimerized Hic-5 oligo was inserted topLVTHM vector between MluI and ClaI restriction enzymesites. Lentiviral construct generation was then performedaccording to the published protocol in HEK293T cells (Wiznerowicz and Trono, 2003). The lacZ control shRNA sequence was:50-GTGACCAGCGAATACCTGT-30 (Qin et al., 2003).

Adenovirus Vectors and Infection:The Myc-Hic-5 adenovirusesused in this study are the same as described previously (Wang et al., 2008). For experiments utilizingthese viruses, cells were plated overnight at 1 X 106 cells/10ml in growth medium, followed by infection withrecombinantadenovirus. After 16 h, cells were washed once with PBSand PBS was replaced with growth medium and maintained for up to 48 h.

Hoechst 33258 staining assay:DU145 and NRP-152 cells were plated in 6 well dishes at a density of 3x104 and 5x104 cells/well respectively. DU145 cellswere cultured in 2 ml of DMEM/F12, 1% FBS, 15 mM HEPES (pH 7.4) whereas NRP-152 cells were culturedin GM3 medium. Cells were treated with vehicle or BMP4 (10 ng/ml) for 72 h and stained with 10 μg/ml Hoechst 33258 dye (Sigma). Apoptotic cellswere counted using fluorescent microscopy. Triplicate samples analyzed, three hundred cells for each (Gama et al., 2009).

Cell viability assay:Cell viability was assessed by Trypan Blue exclusion under phase-contrastmicroscopy as described in (Strober, 2001). Briefly, cells were plated overnight in 12-well dishes in low serum conditions as described in Hoechst staining assay, at a density of10000-50000 cells/1ml/well. Cells were treated with BMP4 (10ng/ml) or vehicle control for 72 h. Cells were detached with Trypsin-EDTA treatment for 5 min and triturated with an equal volume of DMEM/F12 + 5%FBS and 10 μl cell suspensions were combined with 10 μl Trypan Blue dye solution (0.4% [w/v]in normal saline) (Fisher Scientific) and counted with a hemocytometer. The percent viable cells(dye excluded) were determined from a total of at least 300 cells.

Cell number assay:Cells were seeded overnight at 10,000 cells/1ml/well in 12-well dishes in mediumdescribed in Hoechst staining assay. The cells were treated with vehicle control or BMP4 (10 ng/ml) for 72 h, and adherent cells were detached by trypsinization and counted with a Coulter Electronics counter

Immunostaining: PC3 cells or Hic-5-silenced PC3 cells with lacZ controls were grown on chamber slides (Lab-Tek II) overnight in DMEM/F12 supplemented with 15 mM HEPES (pH 7.4) and 1% FBS. The next day, cells were treated with BMP4 (10ng/ml) and/or H2O2 (1mM) for 1h, fixed in 4% paraformaldehyde for 10 min at RT and then washed twice with PBS. After 60 min of blocking with PBS containing 10% goat serum at RT, cells were incubated overnight at 4°C in the same blocking buffer with anti-Hic-5 mouse MoAb (0.25 µg/ml) and/or anti-Smad1 rabbitIgG (2.5 µg/ml). The preparations were then washed three times for 5 min with PBS/0.05% Tween 20 and once with PBS. After incubation with an Alexa-conjugated goat anti-mouse or anti-rabbit antibody (1:250 dilution in PBS/10% goat serum) for Hic-5 and Smad1, respectively, slides were then washed three times with PBS/0.05% Tween 20 and once with PBS. Slides were mounted in Vectashield H-1200 with DAPI according to manufacturer’s instructions.

Retrovirus Vectors and Infection:The retrovirus vector pLPCX was purchased from Clontech Laboratories Inc., (Mountain View, CA). Myc-Hic-5 (Wang et al., 2008) was excised and cloned into pLPCX vector MCS (XhoI & HindIII) and confirmed its DNA sequence and protein expression using standard methods. Using calciumphosphate precipitation method,10 μg of plasmid DNA were transfected along with CMV-VSVG into ABOSC packaging cell. After 24 h, the medium containing the newly synthesized retrovirus was harvested, filtered through a 0.45 μpore membrane. NRP-152 cells (1Χ105 cells/10ml) were infected with viral supernatant overnight in GM2.1 containing 4 μg/ml of protamine sulfate. The medium was replaced the next day with fresh GM2.1 and cells were allowed to recover for a day before selection with puromycin (1.5 μg/ml).

Table1. Primers for Smads1, 5 & 8 truncations

Smad1_FP / 5’aatgtgacaagtttattttcc 3’
Smad1_ MH2_Up / 5’gaggaaccaaaacactggt 3’
Smad1_MH2ML_Up / 5’cctgtacttcctcctgtgc 3’
Smad1_RP / 5’ttaagatacagatgaaatagg 3’
Smad1_MH1_Dn / 5’ataagcaaccgcctgaaca 3’
Smad5_FP / 5’acgtcaatggccagcttgtt 3’
Smad5_MH2_Up / 5’gaagagcctaaacattggt 3’
Smad5_MH2ML_Up / 5’ccagtcttacctccagtat 3’
Smad5_RP / 5’ttatgaaacagaagatatggg 3’
Smad5_MH1_Dn / 5’ataggcaacaggctgaaca 3’
Smad8_FP / 5’cactccaccacccccatcagct3’
Smad8_MH2_Up / 5’gaggagccccagcactggt 3’
Smad8_MH2ML_Up / 5’ccagtactgcctcctgtgc 3’
Smad8_RP / 5’ttaagacactgaagaaatggg 3’
Smad8_MH1_Dn / 5’gtaacaaactggtcgaaag 3’

Smad1(MH1+ML): Smad1_FP, Smad1_MH1_Dn; Smad1(MH2): Smad1_ MH2_Up, Smad1_RP; Smad1(MH2+ML): Smad1_MH2ML_Up, Smad1_RP; Smad5(MH1+ML): Smad5_FP, Smad5_MH1_Dn; Smad5(MH2): Smad5_MH2_Up, Smad5_RP; Smad5(MH2+ML): Smad5_MH2ML_Up, Smad5_RP; Smad8(MH1+ML): Smad8_FP, Smad8_MH1_Dn; Smad8(MH2): Smad8_MH2_Up, Smad8_RP; Smad8(MH2+ML): Smad8_MH2ML_Up, Smad8_RP.

Table2. Primers for Hic-5 mutagenesis

Hic5shMuta-S / 5’ GAGCAGAAGGAGGACCAATCCGAGGATAAGAAAAGACCCAGC 3’
Hic5shMuta-AS / 5’ CTCGTCTTCCTCCTGGTTAGGCTCCTATTCTTTTCTGGGTCG 3’

References

Chipuk J, Cornelius S, Pultz N, Jorgensen J, Bonham M, Kim S et al (2002). The androgen receptor represses transforming growth factor-beta signaling through interaction with Smad3. J Biol Chem277: 1240-8.

Gama V, Gomez J, Mayo L, Jackson M, Danielpour D, Song K et al (2009). Hdm2 is a ubiquitin ligase of Ku70-Akt promotes cell survival by inhibiting Hdm2-dependent Ku70 destabilization. Cell Death Differ16: 758-69.

Qin X, An D, Chen I, Baltimore D (2003). Inhibiting HIV-1 infection in human T cells by lentiviral-mediated delivery of small interfering RNA against CCR5. Proc Natl Acad Sci U S A100: 183-8.

Rahman M, Miyamoto H, Lardy H, Chang C (2003). Inactivation of androgen receptor coregulator ARA55 inhibits androgen receptor activity and agonist effect of antiandrogens in prostate cancer cells. PNAS100: 5124-5129.

Strober W (2001). Trypan blue exclusion test of cell viability. Curr Protoc Immunol.

Wang H, Song K, Krebs T, Yang J, Danielpour D (2008). Smad7 is inactivated through a direct physical interactin with the LIM protein Hic-5/ARA55. Oncogene27: 6791-805.

Wang H, Song K, Sponseller T, Danielpour D (2005). Novel Function of Androgen Receptor-associated Protein 55/Hic-5 as a Negative Regulator of Smad3 Signaling. JBC280: 5154-5162.

Wiznerowicz M, Trono D (2003). Conditional suppression of cellular genes: lentivirus vector-mediated drug-inducible RNA interference. J Virol16: 8957-61.

Supplemental Figure Legends

Figure 1.Western blot analysis of Hic-5 silenced in DU145 and PC3 cells using lentivirus-mediated shRNA as described in published protocol (Wang et al., 2008).

Figure 2. Hic-5 suppresses BMP4 induced apoptosis in NRP-152 cells. Hic-5 was stably overexpressed in NRP-152 cells with retroviral (pLPCX) system, and treated with BMP4 (10 ng/ml) or vehicle control for 72 h. Apoptosis was assessed with Hoechst dye staining.

Figure 3. A mutated-Hic-5, insensitive to sh-Hic-5 was overexpressed in DU145-sh-RNA cells. The wild-type Hic-5 overexpression was knocked down more effectively than the mutated-Hic-5.

Figure 4. Hic-5 inhibits phosphorylation ofAkt by IGF-I in PC3 cells. PC3-sh-Hic-5 and sh-lacZ control were treated with IGF-1 (10 nM) for different time points (6, 15, 30 and 60 mins). The cell lysates were subjected to Western blot and immunoblotted for endogeneous p-Akt, Akt, and Hic-5.

Figure 5. Effects of androgen on Hic-5 protein expression. PC3 cells were transduced with adenovirus-mediated AR expression (PC3-AR-Admax). The PC3-AR-Admax and its control were treated with DHT (10 nM) for 48 h and harvested for Western blot analysis.

Figure 6. Effects of endogeneous Hic-5 on Smad1/5/8 phosphorylation in WPMY-1 cells. Hic-5-silenced WPMY-1 cells and control (WPMY-1-sh-lacZ) cells were subjected to Western blot and immunoblotted for endogeneous p-Smad1/5/8 and Hic-5.

Figure 7. Immunohistochemicalstaining for Hic-5 expression in human tissue(from US BioMax) using a validated monoclonal antibody. Hic-5 expression is shown to be absent in normal prostate epithelium (A)but appeared in stage IV prostate cancer (B), and prostate adenocarcinoma bone metastasis (C) but not in Erwin Sarcoma bone metastasis (D).

Supplementary Figure 7