Name: ______

Stem Cells, Cell Cycle, Cancer, Protein Synthesis – Review Topics Honors

  • Know why cells divide instead of growing: 2 reasons
  • What is a diploid cell?
  • How do you calculate the diploid number of a cell?
  • What are homologous chromosomes?
  • Know the events of the cell cycle – Interphase (G1, S phase, G2) and M-phase (Mitosis) and (Cytokinesis)
  • Be able to define Mitosis and Cytokinesis
  • Know what forms between an animal cell and a plant cell during Cytokinesis (cleavage furrow(animal cells) and cell plate (plant cells))
  • Know what cyclin is and what it does.

Cell Cycle

Matching: Match the correct letter with the correct description. Words are used only once. (1-9)

______1. Uncontrolled cell growth of abnormal cells

______2. A fast growing tumor that spreads to other parts of

the body.

______3. A series of events a cell goes through as it grows and

divides.

______4. Cell that contains two sets of DNA. One set from

mom and the other set from dad.

______5. Division of the nucleus

______6. A slow growing tumor that does not spread to other

parts of the body.

______7. Division of the cytoplasm

______8. Part of the cell cycle where the cell grows and the

DNA replicates.

______9. Proteins that supervise the cell cycle.

Short Answer:

  1. When does a cell begin making a new cell?
  1. What is the role of cyclin within a normal cell?
  1. Describe how a tumor forms.
  1. How is a malignant tumor different from a benign tumor? Use the word metastasizes in your answer.
  1. What are homologous chromosomes?
  1. A human somatic cell contained 46 pieces of DNA, how many pieces of DNA will be found in the cell after Interphase?
  1. A human somatic cell contained 46 pieces of DNA, how many pieces of DNA will be found in the new daughter cells at the end of Mitosis?
  1. A human somatic cell is said to be 2N. What does the 2 and the (N) stand for?
  1. AnAvatar somatic cell has an N value of 26, what is its diploid number for the Avatar’s cell?
  1. If you know that the diploid number for a cell is 64, how many pieces of DNA did mom contribute to this cell?
  1. What are the two parts of the cell cycle?
  1. What is mitosis?
  1. What is cytokinesis?
  1. Why do plant cells have a different method for performing cytokinesis? Explain.
  1. What are two reasons why cells divide instead of continually growing?
  1. Complete the graphic organizer below for a made up cell:

Protein Synthesis –

Use the following DNA sequence to answer the questions that follow:

TACGCCGTAAATCGTGGTAACGCCATC

  1. What will be the mRNA that results from transcription?
  1. If the underlined portions represent introns, what will the mature mRNA be/read?
  1. How many codons does this mature mRNA have? How many tRNA anticodons will there be?
  1. What anticodons will the tRNAs have for this mRNA?
  1. What amino acids will make up the polypeptide?

If a mutation occurred and the DNA became:

TACGCCGTAAATCGAGGTAACGCCATC

  1. What type of mutation is this?
  1. How will the protein be affected (be specific).

Understand how the process of protein synthesis works:

  1. Transcription: GOAL?
  1. where does it occur?
  2. What are roles of transcription factors like activators or repressors?
  3. What is a promoter region? What is a TATA box?
  4. What is the role of RNA polymerase in this process?
  5. How is mRNA made?
  6. When does RNA polymerase know to stop transcription?
  7. What is pre-mRNA?
  8. How do spliceosomes make pre-mRNA into mRNA?
  9. Where does the mRNA go from here?
  1. Translation: GOAL?
  1. Where?
  2. Role of ribosome? tRNA? rRNA?
  3. What is a codon?
  4. What is the start codon?
  5. What are the stop codons?
  6. What could happen if one letter of the DNA was to change (mutate). Explain the possibilities.
  7. How do proteins generate traits?
  8. How many different amino acids are there, and what is their role in translation?
  9. Where did the amino acids floating in your cells’ cytoplasm come from?
  1. Stem cells:

a. what are they?

b. why are they controversial?

c. what is stem cell differentiation?

d. How could stem cells help to treat diseases?