Supplementary Methods:

Patients

Peripheral blood samples from CLL patients were obtained after informed consent in accordance with the Declaration of Helsinki and with Institutional Review Board approval from the National Academy of Medicine, Buenos Aires.At the time of analysis, all patients were untreated or had received no treatment over the prior 6 months. Blood was centrifuged to obtain plasma that was immediately frozen at -20ºC. Mononuclear cells (PBMC) isolation, CLL cell purification and nurse-like cell (NLC) differentiation were performed by standard methods as previously described (ref. 7 in the text)

Nurse-like cell (NLC) differentiation and RNAi-mediated Gal1 knockdown strategies

To differentiate NLC, we cultured PBMC from CLL samples in 6-well plates at a concentration of 2-4 x106/ml for 14 days. Cultures were examined daily by phase-contrast microscopy for the outgrowth of large, adherent cells. Once differentiated, NLC were infected with a recombinant retrovirus encoding a Gal1-specific siRNA oligonucleotide as described5. Briefly, Gal1-specific siRNA was designed by the siRNA Selection Program ( mit.edu/bioc/ siRNAext), synthesized as single-stranded DNA oligonucleotides and annealed. Gal1-specific oligonucleotide (Gal1 RNAi, GATCCGCTGCCAGATGGATACGAATTCAAGAGATTCGTATC- CATCTGGCAGCTTTTTTG) or scrambled oligonucleotide (SCR, GATCCCCTCCATATCTCGCGCGTCTTCAAGAGAGACGCGCGAGATATGGAGGTTTTTTG) was ligated into the linearized pSIREN-RetroQ retroviral vector (BD Clon- tech, Mountain View, CA). Generation of recombinant retrovirus and infection of NLC cells were performed as described (ref. 5 in the text). Thereafter, whole-cell extracts of transiently-infected NLC were prepared and screened for Gal1 expression by immunoblotting as described (ref 8 in the text).

Preparation of Recombinant Gal1

Purification of recombinant Gal1 was accomplished as outlined previously1.LPS contamination was carefully removed by Detoxi-Gel (Pierce) and tested with a Gel Clot Limulus Test (<0.5 IU/mg; Associates of Cape Cod, Falmouth, MA, USA).

Flow cytometry analysis

To evaluate the expression of Gal1 in PBMC, cells (0.5 x 106) were treated with Fix and Perm kit (Caltag Lab) and blocked with 3% BSA. Then 2 μg of FITIC-conjugated anti-Gal1 mAb was added and cells were incubated for 30 min at 4ºC. After washing, cells were suspended in Isoflow and analyzed with a FACSCalibur flow cytometer. Analysis of samples was conducted using CellQuest software (BD Biosciences).The expression of CD80, CD86 and CD25 on CLL cells was evaluated using PE-conjugated specific mAbs and a PerCP-Cy5 conjugated anti-CD19 mAb.

Immunohistochemistry

Paraffin-embedded tissues were cut at 5 µm onto adhesive-coated slides. After dewaxing of paraffin sections, endogenous peroxidase activity was blocked by incubation of slides for 10 min in 3% hydrogen peroxide in methanol. Antigens were retrieved in citrate buffer (pH: 6.0). Then slides were incubated with a rabbit anti-Gal1 polyclonal antibody (1:500) orananti-CD68 mAb (clone PGM1, 1:300, DAKO) followed by an indirect streptavidin-biotin method and staining reaction with DAB (Dako). Preimmune rabbit anti-serum (1:500) was used as control staining for Gal1 and mouse IgG2b (1:100) was used as control staining for CD68.Finally, sections were counterstained with hematoxylin. Semiquantitative analysis of Gal1 expression was performed using a Quantitative Scoring Methods. Briefly, Score (S) was calculated as S=P+I where P= percentage of positive cells and I=intensity of expression. For more details please see the table below:

Score / 0 / 1+ / 2+ / 3+ / 4+
Positive Cells / <10% / 10-25% / 25-50% / 50-75% / >75%
Score / 0 / 1 / 2 / 3
Staining intensity / no staining / weak staining / moderate staining / strong staining

Real-time quantitative RT-PCR

SYBR Green PCR Master Mix was used with an ABI PRISM 7500 Sequence Detection Software (all from Applied Biosystem). Primers used were: human Gal1 forward: 5’-TGAACCTGGGTAAAGACA-3’; reverse: 5’-TTGGCCTGGTCGAAGGTGAT-3’; human GAPDH forward: 5’-GAGTCAACGGATTTGGTCGT-3’; reverse:5’-GACAAGCTTCCCGTTCTCAG-3’; human CCL-3forward: 5´-AGACTTCAGAAGGACACGGG-3´; reverse: 5´-GCATGATTCTGAGCAGGTGA-3´ human CCL4forward: 5´-AGCAAGCAAGTCTGTGCTGA-3´; reverse: 5´-CAGGTGACCTTCCCTGAAGA-3´ human IL-10forward: 5´-TTACCTGGAGGAGGTGATGC-3´; reverse: 5´-GAGGGTCTTCAGGTTCTCCC-3´ human APRILforward: 5´-CTGCACCTGGTTCCCATTAAC-3´; reverse: 5´-AAGAGCTGGTTGCCACATCA-3´; human BAFFforward: 5´-ACCGCGGGACTGAAAATCT-3´; reverse: 5´-CACGCTTATTTCTGCTGTTCTGA-3´.

ELISA for Gal1

Soluble Gal1 was determined using an in-house ELISA2. Briefly, high binding 96-well microplates (Corning Costar) were coated with capture antibody (2 µg/ml purified rabbit anti-Gal1 polyclonal IgG) in 0.1 M sodium carbonate pH 9.5. After incubation for 18 h at 4 ºC, wells were rinsed three times with wash buffer (0.05 % Tween-20 in PBS) and incubated for 1 h at RT with blocking solution (2% BSA in PBS). Samples and standards (100 µl) were diluted in 1% BSA and incubated for 18 h at 4ºC. Plates were then washed and incubated with 100 ng/ml biotinylated detection antibody (purified rabbit anti-Gal1 polyclonal IgG) for 1 h at RT. Plates were rinsed three times before adding horseradish peroxidase-labeled streptavidin (0.33 µg/ml; Sigma) for 30 min at RT. After washing, 100 µl of TMB solution (0.1 mg/ml tetramethylbenzidine and 0.06% H2O2 in citrate-phosphate buffer pH 5.0) was added to the plates. The reaction was stopped by adding 4N H2SO4. Optical densities were determined at 450 nm in a Multiskan MS microplate reader (Thermo Electron Corporation). A standard curve ranging from 2.5 to 160 ng/ml recombinant Gal1 was run in parallel.

ELISA for IL-10 and CCL3

IL-10 and CCL3 were evaluated using commercially available ELISA kits (e-bioscience and Peprotech respectively)

Immunoblot analysis:

CLL cells were preincubated with or without recombinant Gal1 (3M) for 30 min followed by stimulation with F(ab´)2 fragments of anti-human IgM (0.1M). Cells were then washed, lysed and subjected to immunoblot analysis using antibodies against phosphorylated and unphosphorylated Erk1/2 and Syk (all from Santa Cruz).

Statistical analysis:

Comparison between groups was evaluated using the nonparametric Wilcoxon signed rank test. Statistical analyses were performed with GraphPad Prism Software and p values <0.05 were considered statistically significant.

References

1.Barrionuevo P, Beigier-Bompadre M, Ilarregui JM, Toscano MA, Bianco GA, Isturiz MA et al. A novel function for galectin-1 at the crossroad of innate and adaptive immunity: galectin-1 regulates monocyte/macrophage physiology through a nonapoptotic ERK-dependent pathway. J Immunol 2007; 178: 436-445.

2.Ramhorst RE, Giribaldi L, Fraccaroli L, Toscano MA, Stupirski JC, Romero MD et al. Galectin-1 confers immune privilege to human trophoblast: implications in recurrent fetal loss. Glycobiology 2012; 22: 1374-1386.